Previous Contig 005244:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN020F13Sequence598005244 (5)gb:AY062777_15654336e-11Arabidopsis thaliana Unknown protein (At3g07570; MLP3.2) mRNA, complete cds.>gb:
JMSF008J07Sequence275005244 (5)gb:AY062777_15654331e-10Arabidopsis thaliana Unknown protein (At3g07570; MLP3.2) mRNA, complete cds.>gb:600005244 (5)gb:AY062777_15654336e-11Arabidopsis thaliana Unknown protein (At3g07570; MLP3.2) mRNA, complete cds.>gb:
JMSF011H12Sequence267005244 (5)gb:AY062777_15654334e-09Arabidopsis thaliana Unknown protein (At3g07570; MLP3.2) mRNA, complete cds.>gb:426005244 (5)gb:AY062777_15654333e-11Arabidopsis thaliana Unknown protein (At3g07570; MLP3.2) mRNA, complete cds.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN020F13+ CATGTATATATCAATAAATGCATCTTTCCCAAATACAAGAGCAAAAGTCT
rJMSF008J07- AAAGTCT
                      ____________________________________________________________
consensus CATGTATATATCAATAAATGCATCTTTCCCAAATACAAGAGCAAAAGTCT
 
. : . : . : . : . : . :
JMFN020F13+ ACACTGCATATACAGTTTTGGTGTAATGGTCTGAGATAATCTCAAATTCTTCGGTTCCGT
rJMSF008J07- ACACTGCATATACAGTTTTGGTGTAATGGTCTGAGATAATCTCAAATTCTTCGGTTCCGT
                      ____________________________________________________________
consensus ACACTGCATATACAGTTTTGGTGTAATGGTCTGAGATAATCTCAAATTCTTCGGTTCCGT
 
. : . : . : . : . : . :
JMFN020F13+ AAGTTAGGTATCTTAGAAGATCATCCGTCTCTTCTTCCTATTTGCTTAATGTGAAATTTG
rJMSF008J07- AAGTTAGGTATCTTAGAAGATCATCCGTCTCTTCTTCCTATTTGCTTAATGTGAAATTTG
                      ____________________________________________________________
consensus AAGTTAGGTATCTTAGAAGATCATCCGTCTCTTCTTCCTATTTGCTTAATGTGAAATTTG
 
. : . : . : . : . : . :
JMFN020F13+ GGAAGACAGACCATCAAGCCATTCTCTGTTATTAGCGAGAAGAGTGTTTTACATGACAAC
rJMSF008J07- GGAAGACAGACCATCAAGCCATTCTCTGTTATTAGCGAGAAGAGTGTTTTACATGACAAC
rJMSF011H12- GACAAC
                      ____________________________________________________________
consensus GGAAGACAGACCATCAAGCCATTCTCTGTTATTAGCGAGAAGAGTGTTTTACATGACAAC
 
. : . : . : . : . : . :
JMFN020F13+ TTGGAAATGAGTACACCAACGATTTAACAATTTGCAAAACTATTTCCTTCAAAAAGAAAC
rJMSF008J07- TTGGAAATGAGTACACCAACGATTTAACAATTTGCAAAACTATTTCCTTCAAAAAGAAAC
rJMSF011H12- TTGGAAATGAGTACACCAACGATTTAACAATTTGCAAAACTATTTCCTTCAAAAAGAAAC
                      ____________________________________________________________
consensus TTGGAAATGAGTACACCAACGATTTAACAATTTGCAAAACTATTTCCTTCAAAAAGAAAC
 
. : . : . : . : . : . :
JMFN020F13+ ATTGCTTAAGTTTATTATCAAGTCCGAGTGATGCCCTAAACAGATCCAGCCCTTCACTTC
rJMSF008J07- ATTGCTTAAGTTTATTATCAAGTCCGAGTGATGCCCTAAACAGATCCAGCCCTTCACTTC
rJMSF011H12- ATTGCTTAAGTTTATTATCAAGTCCGAGTGATGCCCTAAACAGATCCAGCCCTTCACTTC
                      ____________________________________________________________
consensus ATTGCTTAAGTTTATTATCAAGTCCGAGTGATGCCCTAAACAGATCCAGCCCTTCACTTC
 
. : . : . : . : . : . :
JMFN020F13+ TAATTCCCTTCGCCCTGGTGAGGCTCGGGGTTGTCTTGAAGCACAGTTTCGAGACTTGAG
rJMSF008J07- TAATTCCCTTCGCCCTGGTGAGGCTCGGGGTTGTCTTGAAGCACAGTTTCGAGACTTGAG
JMSF008J07+ GTGAGGCTCGGGGTTGTCTTGAAGCACAGTTTCGAGACTTGAG
rJMSF011H12- TAATTCCCTTCGCCCTGGTGAGGCTCGGGGTTGTCTTGAAGCACAGTTTCGAGACTTGAG
JMSF011H12+ TCTTGAAGCACAGTTTCGAGACTTGAG
                      ____________________________________________________________
consensus TAATTCCCTTCGCCCTGGTGAGGCTCGGGGTTGTCTTGAAGCACAGTTTCGAGACTTGAG
 
. : . : . : . : . : . :
JMFN020F13+ ACTCTGCCTTCCAAGGCGCTGAATTTTTCTTTCAACTGTGAAGAAAGAAGGGTGCGATCG
rJMSF008J07- ACTCTGCCTTCCAAGGCGCTGAATTTTTCTTTCAACTGTGAAGAAAGAAGGGTGCGATCG
JMSF008J07+ ACTCTGCCTTCCAAGGCGCTGAATTTTTCTTTCAACTGTGAAGAAAGAAGGGTGCGATCG
rJMSF011H12- ACTCTGCCTTCCAAGGCGCTGAATTTTTCTTTCAACTGTGAAGAAAGAAGGGTGCGATCG
JMSF011H12+ ACTCTGCCTTCCAAGGCGCTGAATTTTTCTTTCAACTGTGAAGAAAGAAGGGTGCGATCG
                      ____________________________________________________________
consensus ACTCTGCCTTCCAAGGCGCTGAATTTTTCTTTCAACTGTGAAGAAAGAAGGGTGCGATCG
 
. : . : . : . : . : . :
JMFN020F13+ ATTAAGAGATCCCTGAACACGAATTGAGCCATCAACGCCGAGGCAGACGAGAAGCCCAGC
rJMSF008J07- ATTAAGAGATCCCTGAACACGAATTGAGCCATCAACGCCGAGGCAGACGAGAAGCCCAGC
JMSF008J07+ ATTAAGAGATCCCTGAACACGAATTGAGCCATCAACGCCGAGGCAGACGAGAAGCCCAGC
rJMSF011H12- ATTAAGAGATCCCTGAACACGAATTGAGCCATCAACGCCGAGGCAGACGAGAAGCCCAGC
JMSF011H12+ ATTAAGAGATCCCTGAACACGAATTGAGCCATCAACGCCGAGGCAGACGAGAAGCCCAGC
                      ____________________________________________________________
consensus ATTAAGAGATCCCTGAACACGAATTGAGCCATCAACGCCGAGGCAGACGAGAAGCCCAGC
 
. : . : . : . : . : . :
JMFN020F13+ GTGAACCACAGGAACCTTGTTCGCATCATCTTTCTTCTTCACTCTTCCTTCTCCGGTCTC
rJMSF008J07- GTGAACCACAGGAACCTTGTTCGCATCATCTTTCTTCTTCACTCTTCCTTCTCCGGTCTC
JMSF008J07+ GTGAACCACAGGAACCTTGTTCGCATCATCTTTCTTCTTCACTCTTCCTTCTCCGGTCTC
rJMSF011H12- GTGAACCACAGGAACCTTGTTCGCATCATCTTTCTTCTTCACTCTTCCTTCTCCGGTCTC
JMSF011H12+ GTGAACCACAGGAACCTTGTTCGCATCATCTTTCTTCTTCACTCTTCCTTCTCCGGTCTC
                      ____________________________________________________________
consensus GTGAACCACAGGAACCTTGTTCGCATCATCTTTCTTCTTCACTCTTCCTTCTCCGGTCTC
 
. : . : . : . : . : . :
JMFN020F13+ CCTCTCCC
rJMSF008J07- CCTCTCCCTCCGTTATGGGTTTTTTCTACCGCTCGCCGCTCTCGCTTGCC
JMSF008J07+ CCTCTCCCTCCGTTATGGGTTTTTTCTACCGCTCGCCGCTCTCGCTTGCC
rJMSF011H12- CCTCTCCCTCCGTTATGGGTTTTTTCTACCGCTCGCCGCTCTCGCTTGCCTGTCCTCCCC
JMSF011H12+ CCTCTCCCTCCGTTATGGGTTTTTTCTACCGCTCGCCGCTCTCGCTTGCCTGTCCTCCCC
                      ____________________________________________________________
consensus CCTCTCCCTCCGTTATGGGTTTTTTCTACCGCTCGCCGCTCTCGCTTGCCTGTCCTCCCC