Previous Contig 005241:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011H04Sequence106005241 (10)723012505 (12)pir|T09661|T096614e-24ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF015C04Sequence168005241 (10)753012505 (12)pir|T09661|T096614e-24ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF017M19Sequence120005241 (10)699012505 (12)pir|T09661|T096614e-24ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF019G01Sequence247005241 (10)gb:AB125880_15282222e-35Ipomoea batatas SRF1 mRNA for dof zing finger protein, partial cds.666012505 (12)pir|T09661|T096618e-23ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF019H01Sequence249005241 (10)gb:AB125880_15282224e-36Ipomoea batatas SRF1 mRNA for dof zing finger protein, partial cds.659012505 (12)pir|T09661|T096618e-23ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF019N11Sequence123005241 (10)755012505 (12)pir|T09661|T096614e-24ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF019P08Sequence119005241 (10)706012505 (12)pir|T09661|T096614e-24ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF034N24Sequence468005241 (10)gb:AB125880_15282221e-19Ipomoea batatas SRF1 mRNA for dof zing finger protein, partial cds.595012505 (12)pir|T09661|T096613e-17ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF046E05Sequence136005241 (10)681012505 (12)pir|T09661|T096619e-23ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459
JMSF048D11Sequence402005241 (10)gb:AB125880_15282226e-19Ipomoea batatas SRF1 mRNA for dof zing finger protein, partial cds.750012505 (12)pir|T09661|T096614e-24ascorbate oxidase promoter-binding protein AOBP - winter squash>gb:D45066_167459

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019H01+ ATCAG
JMSF019G01+ CAG
                      ____________________________________________________________
consensus ATCAG
 
. : . : . : . : . : . :
JMSF019H01+ GTTTCTTCAGAGTTTTCTGCTCTGAATTGTTTGTTTCGGTTTGATCACTTTCAGTCTTGG
JMSF019G01+ GTTTCTTCAGAGTTTTCTGCTCTGAATTGTTTGTTTCGGTTTGATCACTTTCAGTCTTGG
                      ____________________________________________________________
consensus GTTTCTTCAGAGTTTTCTGCTCTGAATTGTTTGTTTCGGTTTGATCACTTTCAGTCTTGG
 
. : . : . : . : . : . :
JMSF019H01+ AAAGTTTTGGCGAAGGAGAGTCTTCATCAACAGGGGGAGTTTTGACACTGTTGTCTGATT
JMSF019G01+ AAAGTTTTGGCGAAGGAGAGTCTTCATCAACAGGGGGAGTTTTGACACTGTTGTCTGATT
                      ____________________________________________________________
consensus AAAGTTTTGGCGAAGGAGAGTCTTCATCAACAGGGGGAGTTTTGACACTGTTGTCTGATT
 
. : . : . : . : . : . :
JMSF019H01+ CTGACTCATTCTTAGTACTCTCTAACTCATCCATGTCCTGATCTTGATCTTTCTCTTCAG
JMSF019G01+ CTGACTCATTCTTAGTACTCTCTAACTCATCCATGTCCTGATCTTGATCTTTCTCTTCAG
JMSF048D11+ TTCAG
JMSF034N24+ TTAGTACTCTCTAACTCATCCATGTCCTGATCTTGATCTTTCTCTTCAG
                      ____________________________________________________________
consensus CTGACTCATTCTTAGTACTCTCTAACTCATCCATGTCCTGATCTTGATCTTTCTCTTCAG
 
. : . : . : . : . : . :
JMSF019H01+ AAAACTCATCTGATAAAAGTTCCTTATCATCATCCTCTCGCTTTTGTGTATCAAATTCGT
JMSF019G01+ AAAACTCATCTGATAAAAGTTCCTTATCATCATCCTCTCGCTTTTGTGTATCAAATTCGT
JMSF048D11+ AAAACTCATNTGATAAAAGTTCCTTATCATCATCCTCTCGCTTTTGGGTATCAAATTNGT
JMSF034N24+ AAAACTCATNTGATAAAAGTTCCTTATCATCATCCTCTCGCTTTTGNGTATCAAATTNGT
                      ____________________________________________________________
consensus AAAACTCATCTGATAAAAGTTCCTTATCATCATCCTCTCGCTTTTGTGTATCAAATTCGT
 
. : . : . : . : . : . :
JMSF019H01+ CAA
JMSF019G01+ CAA
JMSF048D11+ CAACATCAGNTCCTCCCTTCCCAGAGCTACCGTNGAGTTTGNTGTCATCCGAACAGCGAT
JMSF034N24+ CAACATCAGCTCCTCCCTTCCCAGAGCTACCGTTGAGTTTGCTGTCATCCGAACAGCGAT
                      ____________________________________________________________
consensus CAACATCAGCTCCTCCCTTCCCAGAGCTACCGTTGAGTTTGCTGTCATCCGAACAGCGAT
 
. : . : . : . : . : . :
JMSF048D11+ CGCGCTTGGAGCCNCCGTCGTTTTCACANGACTCAGNGTATTTTCCGGNGGNGGCGAGCN
JMSF034N24+ CGCGCTNGGAGCCNCNGTCGTTTTCACATGACTCAGNGTATTNTCCGGNGGCGGCGAGCA
                      ____________________________________________________________
consensus CGCGCTTGGAGCCNCCGTCGTTTTCACATGACTCAGNGTATTTTCCGGNGGCGGCGAGCA
 
. : . : . : . : . : . :
JMSF048D11+ CCNCCCTGCCGTACTCCGGCAAGGCAATTTTCTTGCCGAACAGCTTGATNTCCGAGTCCT
JMSF034N24+ CCNCCCTGCCGTANTCCGGCAAGGCAATTTTCTTGCCGAACAGCTTGATNTCCGAGTCCT
                      ____________________________________________________________
consensus CCNCCCTGCCGTACTCCGGCAAGGCAATTTTCTTGCCGAACAGCTTGATNTCCGAGTCCT
 
. : . : . : . : . : . :
JMSF048D11+ TCACTTNTNTCATTTTTCTCGGTACAAAAAAAATGAAGTGGTTTAGCCNCGCTCCGTCGT
JMSF034N24+ TCACTTCTNTCATTTTTCTCGGTACAAAAAAAATGAAGTGGTTTAGCCNCGCTCCGTCGT
JMSF015C04+ CATTTTTCTCGGTACAAAAAAAATGAAGNGGNTTAGCCCCGCTCCGTNGT
JMSF017M19+ GT
                      ____________________________________________________________
consensus TCACTTCTNTCATTTTTCTCGGTACAAAAAAAATGAAGTGGTTTAGCCCCGCTCCGTCGT
 
. : . : . : . : . : . :
JMSF048D11+ GGGCGGCGGCGAGTGGGTTTGGGAAACGT--AAAAAAAAAAGAAAGAAAATAGCTAAGGG
JMSF034N24+ GGGCGGCGGCGAGTGGGTTTGGGAAACGT--AAAAAAAAAAGAAAGAAAATAGCTAAGGG
JMSF015C04+ GGGCGGCGGCGAGTGGGTTTGGGAAACGT-AAAAAAAAAAAGAAAGAAAATAGCTAAGGG
JMSF019P08+ GAGTGGGTTTGGGAAACGTAAAAAAAAAAAAGAAAGAAAATAGCTAAGGG
JMSF046E05+ GGGTTTGGGAAACGTAAAAAAAAAAAAGAAAGAAAATAGCTAAGGG
JMSF019N11+ GAGTGGGTTTGGGAAACGTAAAAAAAAAAAAGAAAGAAAATAGCTAAGGG
JMSF017M19+ GGGNGGCGGNGAGTGGGTTTGGGAAACGT-AAAAAAAAAAAGAAAGAAAATAGCTAAGGG
JMSF011H04+ GGGTTTGGGAAACGTAAAAAAAAAAAAGAAAGAAAATAGCTAAGGG
                      ____________________________________________________________
consensus GGGCGGCGGCGAGTGGGTTTGGGAAACGTAAAAAAAAAAAAGAAAGAAAATAGCTAAGGG
 
. : . : . : . : . : . :
JMSF048D11+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCT
JMSF034N24+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTTGGCTATGC
JMSF015C04+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTTGGCTATGC
JMSF019P08+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTTGGCTATGCTC
JMSF046E05+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTTGGCTATGC
JMSF019N11+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTTGGCTATGCTC
JMSF017M19+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTTGGCTATGCTC
JMSF011H04+ GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTNGGCTATGCTCC
                      ____________________________________________________________
consensus GGCGTTTGGGGAGAGTTTTTGAATTTGTAAATTCTGAAAAGGCCTCGTTGGCTATGCTCC