Previous Contig 005236:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018J14Sequence614005236 (10)gb:ATAC013483_15435655e-84Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen
JMFN030B21Sequence513005236 (10)gb:ATAC013483_15435654e-62Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen
JMFN032O12Sequence137005236 (10)
JMFN040A23Sequence606005236 (10)gb:ATAC013483_15435657e-74Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen
JMFN044J15Sequence627005236 (10)gb:AC135958_17429692e-52Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete sequence.
JMFS075C07Sequence637005236 (10)gb:ATAC013483_15435652e-75Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen
JMSF011G07Sequence349005236 (10)gb:ATAC013483_15435651e-28Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen723005236 (10)gb:ATAC013483_15435654e-66Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen
JMSF033E09Sequence675005236 (10)gb:ATAC013483_15435654e-79Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen694005236 (10)gb:AC135958_17429694e-58Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033E09- AAAGAT
                      ____________________________________________________________
consensus AAAGAT
 
. : . : . : . : . : . :
JMFN044J15+ AGGCAATTACATGGTTGCAACATATGACTCACATTTGACACTTT
rJMSF033E09- ATAGATTTATAGTCTAAGGCAATTACATGGTTGCAACATATGACTCACATTTGACACTTT
rJMSF011G07- TGGTTGCAACATATGACTCACATTTGACACTTT
                      ____________________________________________________________
consensus ATAGATTTATAGTCTAAGGCAATTACATGGTTGCAACATATGACTCACATTTGACACTTT
 
. : . : . : . : . : . :
JMFN044J15+ ACTAACCATTGCAACAACTCTACCAACCATTCATTACACACACAAAAAACTTGTCGGGAA
rJMSF033E09- ACTAACCATTGCAACAACTCTACCAACCATTCATTACACACACAAAAAACTTGTCGGGAA
rJMSF011G07- ACTAACCATTGCAACAACTCTACCAACCATTCATTACACACACAAAAAACTTGTCGGGAA
                      ____________________________________________________________
consensus ACTAACCATTGCAACAACTCTACCAACCATTCATTACACACACAAAAAACTTGTCGGGAA
 
. : . : . : . : . : . :
JMFN044J15+ TACAACAACGTTTTTAAAAAGGATTGTACTTCAATCTCGAGAGCCTCAACCTGCTCCTAT
rJMSF033E09- TACAACAACGTTTTTAAAAAGGATTGTACTTCAATCTCGAGAGCCTCAACCTGCTCCTAT
rJMSF011G07- TACAACAACGTTTTTAAAAAGGATTGTACTTCAATCTCGAGAGCCTCAACCTGCTCCTAT
                      ____________________________________________________________
consensus TACAACAACGTTTTTAAAAAGGATTGTACTTCAATCTCGAGAGCCTCAACCTGCTCCTAT
 
. : . : . : . : . : . :
JMFN044J15+ CGTGGAGCCTACAACGACATCGTTCTCTGGTCTAGACAGCGGGGGAGACCTTAACCTCGT
rJMSF033E09- CGTGGAGCCTACAACGACATCGTTCTCTGGTCTAGACAGCGGGGGAGACCTTAACCTCGT
rJMSF011G07- CGTGGAGCCTACAACGACATCGTTCTCTGGTCTAGACAGCGGGGGAGACCTTAACCTCGT
                      ____________________________________________________________
consensus CGTGGAGCCTACAACGACATCGTTCTCTGGTCTAGACAGCGGGGGAGACCTTAACCTCGT
 
. : . : . : . : . : . :
JMFN044J15+ CGAGAACCGGGCCACAGAGAGTTCCATAGTCATTGATCCTAGTATGGTAAAAGGAGCTGA
rJMSF033E09- CGAGAACCGGGCCACAGAGAGTTCCATAGTCATTGATCCTAGTATGGTAAAAGGAGCTGA
rJMSF011G07- CGAGAACCGGGCCACAGAGAGTTCCATAGTCATTGATCCTAGTATGGTAAAAGGAGCTGA
                      ____________________________________________________________
consensus CGAGAACCGGGCCACAGAGAGTTCCATAGTCATTGATCCTAGTATGGTAAAAGGAGCTGA
 
. : . : . : . : . : . :
JMFN044J15+ AGAAAGTTAACCTAGTTCTGATTGAAATGGCAGTGAACCTGAAGCTGACAGATTTGGAGT
rJMSF033E09- AGAAAGTTAACCTAGTTCTGATTGAAATGGCAGTGAACCTGAAGCTGACAGATTTGGAGT
rJMSF011G07- AGAAAGTTAACCTAGTTCTGATTGAAATGGCAGTGAACCTGAAGCTGACAGATTTGGAGT
                      ____________________________________________________________
consensus AGAAAGTTAACCTAGTTCTGATTGAAATGGCAGTGAACCTGAAGCTGACAGATTTGGAGT
 
. : . : . : . : . : . :
JMFN044J15+ GGCCTTTCCCGACGGATCTGAAGGGAACTTTGAAGGCGCTCTTGCCTGCAAACGCCTCGA
rJMSF033E09- GGCCTTTCCCGACGGATCTGAAGGGAACTTTGAAGGCGCTCTTGCCTGCAAACGCCTCGA
rJMSF011G07- GGCCTTTCCCGACGGATCTGAAGGGAACTTTGAAGGCGCTCTTGCCTGCAAACGCCTCGA
                      ____________________________________________________________
consensus GGCCTTTCCCGACGGATCTGAAGGGAACTTTGAAGGCGCTCTTGCCTGCAAACGCCTCGA
 
. : . : . : . : . : . :
JMFN044J15+ CCATCATGTCGCCATGGCAGCCGTTCTTGGCGTCTCCCACGGTGAACGCTAGGGTGTAGA
rJMSF033E09- CCATCATGTCGCCATGGCAGCCGTTCTTGGCGTCTCCCACGGTGAACGCTAGGGTGTAGA
rJMSF011G07- CCATCATGTCGCCATGGCAGCCGTTCTTGGCGTCTCCCACGGTGAACGCTAGGGTGTAGA
                      ____________________________________________________________
consensus CCATCATGTCGCCATGGCAGCCGTTCTTGGCGTCTCCCACGGTGAACGCTAGGGTGTAGA
 
. : . : . : . : . : . :
JMFN044J15+ CCTTATTCGGGACGGTTCTGATGATCTGTGCAATCGCACTTTCCCTCCCTGCCACCAGCT
rJMSF033E09- CCTTATTCGGGACGGTTCTGATGATCTGTGCAATCGCACTTTCCCTCCCTGCCACCAGCT
rJMSF011G07- CCTTATTCGGGACGGTTCTGATGATCTGTGCAATCGCACTTTCCCTCCCTGCCACCAGCT
                      ____________________________________________________________
consensus CCTTATTCGGGACGGTTCTGATGATCTGTGCAATCGCACTTTCCCTCCCTGCCACCAGCT
 
. : . : . : . : . : . :
JMFN044J15+ CGACTGCTGCCCGCCCGAAGGGGATGTTGAAGTGGGCTGCGTCTATGTACTTGACCGCCT
rJMSF033E09- CGACTGCTGCCCGCCCGAAGGGGATGTTGAAGTGGGCTGCGTCTATGTACTTGACCGCCT
rJMSF011G07- CGACTGCTGCCCGCCCGAAGGGGATGTTGAAGTGGGCTGCGTCTATGTACTTGACCGCCT
JMFN018J14+ TTGAAGTGGGCTGCGTCTATGTACTTGACCGCCT
                      ____________________________________________________________
consensus CGACTGCTGCCCGCCCGAAGGGGATGTTGAAGTGGGCTGCGTCTATGTACTTGACCGCCT
 
. : . : . : . : . : . :
JMFN044J15+ TGAGCGACTCGATTAGCCAGCCTGGAAGCGGGGATACCATGTC
rJMSF033E09- TGAGCGACTCGATTAGCCAGCCTGGAAGCGGGGATACCATGTCTTGCTGCTTTGGAGGGA
rJMSF011G07- TGAGCGACTCGATTAGCCAGCCTGGAAGCGGGGATACCATGTCTTGCTGCTTTGGAGGGA
JMFN030B21+ GGAGGGA
JMFN018J14+ TGAGCGACTCGATTAGCCAGCCTGGAAGCGGGGATACCATGTCTTGCTGCTTTGGAGGGA
                      ____________________________________________________________
consensus TGAGCGACTCGATTAGCCAGCCTGGAAGCGGGGATACCATGTCTTGCTGCTTTGGAGGGA
 
. : . : . : . : . : . :
rJMSF033E09- GGAGAACGCCGTTTGAAGCGTTCCTTAG
rJMSF011G07- GGAGAACGCCGTTTGAAGCGTTCCTTA-GCCGGTGAGGACCCTCCTCAAACCCGTTGTTC
JMFN030B21+ GGAGAACGCCGTTTGAAGCGTTCCTTAGGCCGGTGAGGACCCTCCTCAAACCCGTTGTTC
JMFN018J14+ GGAGAACGCCGTTTGAAGCGTTCCTTA-GCCGGTGAGGACCCTCCTCAAACCCGTTGTTC
JMFS075C07+ A-GCCGGTGAGGACCCTCCTCAAACCCGTTGTTC
JMFN040A23+ GACCCTCCTCAAACCCGTTGTTC
JMSF033E09+ GAGAACGCCGTTTGAAGCGTTCCTTA-GCCGGTGAGGACCCTCCTCAAACCCGTTGTTC
                      ____________________________________________________________
consensus GGAGAACGCCGTTTGAAGCGTTCCTTA-GCCGGTGAGGACCCTCCTCAAACCCGTTGTTC
 
. : . : . : . : . : . :
rJMSF011G07- CTCACCAAATTCTCTCTAGTGGGCAATACAG
JMFN030B21+ CTCACCAAATTCTCTGTAGTGGGCAATACAGGCAGGAGTTCCTTAATAGCAACAGCATCA
JMFN018J14+ CTCACCAAATTCTCTCTAGTGGGCAATACAGGCAGGAGTTCCTTAATAGCAACAGCATCA
JMFS075C07+ CTCACCAAATTCTCTCTAGTGGGCAATACAGGCAGGAGTTCCTTAATAGCAACAGCATCA
JMFN040A23+ CTCACCAAATTCTCTCTAGTGGGCAATACAGGCAGGAGTTCCTTAATAGCAACAGCATCA
JMSF033E09+ CTCACCAAATTCTCTCTAGTGGGCAATACAGGCAGGAGTTCCTTAATAGCAACAGCATCA
                      ____________________________________________________________
consensus CTCACCAAATTCTCTCTAGTGGGCAATACAGGCAGGAGTTCCTTAATAGCAACAGCATCA
 
. : . : . : . : . : . :
JMFN030B21+ ATGAGAGGTCCACAAGTGGGATCTTCTTGCTTCCCAGGGTTATGGAACGTCACCATTGCA
JMFN018J14+ ATGAGAGGTCCACAAGTGGGATCTTCTTGCTTCCCAGGGTTATGGAACGTCACCATTGCA
JMFS075C07+ ATGAGAGGTCCACAAGTGGGATCTTCTTGCTTCCCAGGGTTATGGAACGTCACCATTGCA
JMFN040A23+ ATGAGAGGTCCACAAGTGGGATCTTCTTGCTTCCCAGGGTTATGGAACGTCACCATTGCA
JMSF033E09+ ATGAGAGGTCCACAAGTGGGATCTTCTTGCTTCCCAGGGTTATGGAACGTCACCATTGCA
                      ____________________________________________________________
consensus ATGAGAGGTCCACAAGTGGGATCTTCTTGCTTCCCAGGGTTATGGAACGTCACCATTGCA
 
. : . : . : . : . : . :
JMFN030B21+ GCCTCAGAAGCGGCTCTGAAAGCAAAGGAAACCACATCGCCGCCATTGCTGCTGTAAAGT
JMFN018J14+ GCCTCAGAAGCGGCTCTGAAAGCAAAGGAAACCACATCGCCGCCATTGCTGCTGTAAAGT
JMFS075C07+ GCCTCAGAAGCGGCTCTGAAAGCAAAGGAAACCACATCGCCGCCATTGCTGCTGTAAAGT
JMFN040A23+ GCCTCAGAAGCGGCTCTGAAAGCAAAGGAAACCACATCGCCGCCATTGCTGCTGTAAAGT
JMSF033E09+ GCCTCAGAAGCGGCTCTGAAAGCAAAGGAAACCACATCGCCGCCATTGCTGCTGTAAAGT
                      ____________________________________________________________
consensus GCCTCAGAAGCGGCTCTGAAAGCAAAGGAAACCACATCGCCGCCATTGCTGCTGTAAAGT
 
. : . : . : . : . : . :
JMFN030B21+ GTCTGCAGAGGAATGTCTCCGGACAAGGGGGGAACCGACACCCTCAAAACCTCTTCCTGC
JMFN018J14+ GTCTGCAGAGGAATGTCTCCGGACAAGGGGGGAACCGACACCCTCAAAACCTCTTCCTGC
JMFS075C07+ GTCTGCAGAGGAATGTCTCCGGACAAGGGGGGAACCGACACCCTCAAAACCTCTTCCTGC
JMFN040A23+ GTCTGCAGAGGAATGTCTCCGGACAAGGGGGGAACCGACACCCTCAAAACCTCTTCCTGC
JMSF033E09+ GTCTGCAGAGGAATGTCTCCGGACAAGGGGGGAACCGACACCCTCAAAACCTCTTCCTGC
                      ____________________________________________________________
consensus GTCTGCAGAGGAATGTCTCCGGACAAGGGGGGAACCGACACCCTCAAAACCTCTTCCTGC
 
. : . : . : . : . : . :
JMFN030B21+ GCGCACGTTCTCGACGCCGCAAATGTCAGCGCGTAAAGAGCCCCCTTCTTCACCGGGATG
JMFN018J14+ GCGCACGTTCTCGACGCCGCAAATGTCAGCGCGTAAAGAGCCCCCTTCTTCACCGGGATG
JMFS075C07+ GCGCACGTTCTCGACGCCGCAAATGTCAGCGCGTAAAGAGCCCCCTTCTTCACCGGGATG
JMFN040A23+ GCGCACGTTCTCGACGCCGCAAATGTCAGCGCGTAAAGAGCCCCCTTCTTCACCGGGATG
JMSF033E09+ GCGCACGTTCTCGACGCCGCAAATGTCAGCGCGTAAAGAGCCCCCTTCTTCACCGGGATG
                      ____________________________________________________________
consensus GCGCACGTTCTCGACGCCGCAAATGTCAGCGCGTAAAGAGCCCCCTTCTTCACCGGGATG
 
. : . : . : . : . : . :
JMFN030B21+ TTCTGCGATATCGACGCCTCGTTTCCCAGCCTCACGGCGTGGACGCCGTGCGCCACCGGA
JMFN018J14+ TTCTGCGATATCGACGCCTCGTTTCCCAGCCTCACGGCGTGGACGCCGTGCGCCACCGGA
JMFS075C07+ TTCTGCGATATCGACGCCTCGTTTCCCAGCCTCACGGCGTGGACGCCGTGCGCCACCGGA
JMFN040A23+ TTCTGCGATATCGACGCCTCGTTTCCCAGCCTCACGGCGTGGACGCCGTGCGCCACCGGA
JMSF033E09+ TTCTGCGATATCGACGCCTCGTTTCCCAGCCTCACGGCGTGGACGCCGTGCGCCACCGGA
JMSF011G07+ CGACGCCTCGTTTCCCAGCCTCACGGCGTGGACGCCGTGCGCCACCGGA
                      ____________________________________________________________
consensus TTCTGCGATATCGACGCCTCGTTTCCCAGCCTCACGGCGTGGACGCCGTGCGCCACCGGA
 
. : . : . : . : . : . :
JMFN030B21+ AAGAACATCCCCCCCGGCTGCGGCCCGCCGGAGATGTACTCCACTAGGCCGGAGGTTTCC
JMFN018J14+ AAGAACATCCCCCCCGGCTGCGGCCCGCCGGAGATGTACTCCACTAGGCCGGAGGTTTCC
JMFS075C07+ AAGAACATCCCCCCCGGCTGCGGCACGCCGGAGATGTACTCCACTAGGCCGGAGGTTTCC
JMFN040A23+ AAGAACATCCCCCCCGGCTGCGGCCCGCCGGAGATGTACTCCACTAGGCCGGAGGTTTCC
JMSF033E09+ AAGAACATCCCCCCCGGCTGCGGCCCGCCGGAGATGTACTCCACTAGGCCGGAGGTTTCC
JMSF011G07+ AAGAACATCCCCCCCGGCTGCGGCCCGCCGGAGATGTACTCCACTAGGCCGGAGGTTTCC
                      ____________________________________________________________
consensus AAGAACATCCCCCCCGGCTGCGGCCCGCCGGAGATGTACTCCACTAGGCCGGAGGTTTCC
 
. : . : . : . : . : . :
JMFN030B21+ CATCTCGGCAGCG
JMFN018J14+ CATCTCGGCAGCGCGTGTTTC
JMFN032O12+ TTATGTCACTCGCCTTCGGA
JMFS075C07+ CATCTCGGCAGCGCGTGTTTCCCTTGGAGAACTGTTTTCTTTATGTCACTCGCCTTCGGA
JMFN040A23+ CATCTCGGCAGCGCGTGTTTCCCTTGGAGAACTGTTTTCTTTATGTCACTCGCCTTCGGA
JMSF033E09+ CATCTCGGCAGCGCGTGTTTCCCTTGGAGAACTGTTTTCTTTATGTCACTCGCCTTCGGA
JMSF011G07+ CATCTCGGCAGCGCGTGTTTCCCTTGGAGAACTGTTTTCTTTATGTCACTCGCCTTCGGA
                      ____________________________________________________________
consensus CATCTCGGCAGCGCGTGTTTCCCTTGGAGAACTGTTTTCTTTATGTCACTCGCCTTCGGA
 
. : . : . : . : . : . :
JMFN032O12+ CCCTCCTCAAAGTTCCCATTTGGCAGAAAACCTTCAAGAGGAGCATTTAGAGCAGAAACA
JMFS075C07+ CCCTCCTCAAAGTTCCCATTTGGCAGAAAACCTTCAAGAGGAGCATTTAGAGCAGAAACA
JMFN040A23+ CCCTCCTCAAAGTTCCCATTTGGCAGAAAACCTTCAAGAGGAGCATTTAGAGCAGAAACA
JMSF033E09+ CCCTCCTCAAAGTTCCCATTTGGCAGAAAACCTTCAAGAGGAGCATTTAGAGCAGAAACA
JMSF011G07+ CCCTCCTCAAAGTTCCCATTTGGCAGAAAACCTTCAAGAGGAGCATTTAGAGCAGAAACA
                      ____________________________________________________________
consensus CCCTCCTCAAAGTTCCCATTTGGCAGAAAACCTTCAAGAGGAGCATTTAGAGCAGAAACA
 
. : . : . : . : . : . :
JMFN032O12+ GCTAAAACTAAGCAGAAAAAGAGCGCAAAACAAATCTTGGCAGCCATTTTTGTGGGA
JMFS075C07+ GCTAAAACTAAGCAGAAAAAGAGCGCAAAACAAATCTTGGCAGCCATTTTTGTGGGA
JMFN040A23+ GCTAAAACTAAGCAGAAAAAGAGCGCAAAACAAATCTTGGCAG
JMSF033E09+ GCTAAAACTAAGCAGAAAAAGAGCGCAAAACAAATCTTGGCAGCCATTTTTGTGGGATTA
JMSF011G07+ GCTAAAACTAAGCAGAAAAAGAGCGCAAAACAAATCTTGGCAGCCATTTTTGTGGGATTA
                      ____________________________________________________________
consensus GCTAAAACTAAGCAGAAAAAGAGCGCAAAACAAATCTTGGCAGCCATTTTTGTGGGATTA
 
. : . : . : . : . : . :
JMSF033E09+ AGCTAAAAAGGGATAG
JMSF011G07+ AGCTAAAAAGGGATAGGGCTTTCTCTCTAGAATGCTTCACTGCATTTATATACTCCCACC
                      ____________________________________________________________
consensus AGCTAAAAAGGGATAGGGCTTTCTCTCTAGAATGCTTCACTGCATTTATATACTCCCACC