Previous Contig 005235:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002N21Sequence226005235 (6)707008245 (6)pir|B86170|B861702e-11ADK1 [imported] - Arabidopsis thaliana>gb:AE005172_889412 Arabidopsis thaliana c
JMFF008M10Sequence246005235 (6)645008245 (6)gb:AF462864_18019728e-10Arabidopsis thaliana AT5g44100/MLN1_2 mRNA, complete cds.
JMFF032D09Sequence246005235 (6)698008245 (6)gb:AF462864_18019722e-11Arabidopsis thaliana AT5g44100/MLN1_2 mRNA, complete cds.
JMSF007A11Sequence147005235 (6)746008245 (6)pir|B86170|B861704e-25ADK1 [imported] - Arabidopsis thaliana>gb:AE005172_889412 Arabidopsis thaliana c
JMSF011G05Sequence238005235 (6)719008245 (6)gb:AY099715_15767401e-13Arabidopsis thaliana protein kinase ADK1-like protein (At4g28540) mRNA, complete
JMSF041K20Sequence238005235 (6)673008245 (6)pir|B86170|B861701e-11ADK1 [imported] - Arabidopsis thaliana>gb:AE005172_889412 Arabidopsis thaliana c

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF008M10+ TNCGNAAACNNTGGAA
                      ____________________________________________________________
consensus TNCGNAAACNNTGGAA
 
. : . : . : . : . : . :
JMFF032D09+ TTAAAAAAAAAAAAACAACCTCGTAGGGCCGGGGGAGACAAACGGGCGAAGATTGGGG
JMSF041K20+ AAAAAAAAAAAAACAACCTCGTAGGGCCGGGGGAGACAAACGGGCGAAGATTGGGG
JMSF007A11+ AAAAAAAAAAAAACAACCTCGTAGGGCCGGGGGAGACAAACGGGCGAAGATTGGGG
JMFF008M10+ ANTTAAAAAAAAAAAAACAACCTCGTAGGGCCGGGGGAGACAAACGGGCGAAGATTGGGG
JMFF002N21+ AAAAAAAAAAAAACAACCTCGTAGGGCCGGGGGAGACAAACGGGCGAAGATTGGGG
JMSF011G05+ AAAAAAAAAAAAACAACCTCGTAGGGCCGGGGGAGACAAACGGGCGAAGATTGGGG
                      ____________________________________________________________
consensus ANTTAAAAAAAAAAAAACAACCTCGTAGGGCCGGGGGAGACAAACGGGCGAAGATTGGGG
 
. : . : . : . : . : . :
JMFF032D09+ AGAGAGAAAGGGGGGGAAAAAGCGTATTTCAGAAAAAGCAAATGGTTTTGTGCGACAATG
JMSF041K20+ AGAGAGAAAGGGGGGGAAAAAGCGTATTTCAGAAAAAGCAAATGGTTTTGTGCGACAATG
JMSF007A11+ AGAGAGAAAGGGGGGGAAAAAGCGTATTTCAGAAAAAGCAAATGGTTTTGTGCGACAATG
JMFF008M10+ AGAGAGAAAGGGGGGGAAAAAGCGTATTTCAGAAAAAGCAAATGGTTTTGTGCGACAATG
JMFF002N21+ AGAGAGAAAGGGGGGGAAAAAGCGTATTTCAGAAAAAGCAAATGGTTTTGTGCGACAATG
JMSF011G05+ AGAGAGAAAGGGGGGGAAAAAGCGTATTTCAGGAAAAGCAAATGGTTTTGTGCGACAATG
                      ____________________________________________________________
consensus AGAGAGAAAGGGGGGGAAAAAGCGTATTTCAGAAAAAGCAAATGGTTTTGTGCGACAATG
 
. : . : . : . : . : . :
JMFF032D09+ AGAGAGAATGATTGACTGAATGAATGAATATA-CGTGGGAATGGTGGTGGTGGTGGTGGG
JMSF041K20+ AGAGAGAATGATTGACTGAATGAATGAATATATCGTGGGAATGGTGGTGGTGGTGGTGGG
JMSF007A11+ AGAGAGAATGATTGACTGAATGAAT
JMFF008M10+ AGAGAGAATGATTGACTGAATGAATGAATATA-CGTGGGAATGGTGGTGGTGGTGGTGGG
JMFF002N21+ AGAGAGAATGATTGACTGAATGAATGAATATA-CGTGGGAATGGTGGTGGTGGTGGTGGG
JMSF011G05+ AGAGAGAATGATTGACTGAATGAATGAATATA-CGTGGGAATGGTGGTGGTGGTGGTGGG
                      ____________________________________________________________
consensus AGAGAGAATGATTGACTGAATGAATGAATATA-CGTGGGAATGGTGGTGGTGGTGGTGGG
 
. : . : . : . : . : . :
JMFF032D09+ AGAGAGGGCCAGAGAAGAAGAAACGAGGCAGCCAGCCAGCAGGTGGCAATC
JMSF041K20+ AGAGAGGGCCAGAGAAGAAGAAACGAGGCAGCCAGCCAGCAGGTGGCAA
JMFF008M10+ AGAGAGGGCCAGAGAAGAAGAAACGAGGCAGCCAGCCAGCAGGTGGCAATC
JMFF002N21+ AGAGAGGGCCAGAGAAGAAGAAACGAGGCAGCCAGCCAGCAGGTGGCAATC
JMSF011G05+ AGAGAGGGCCAGAGAAGAAGAAACGAGGCAGCCAGCCAGCAGGTGGCAATCATTTTTCTT
                      ____________________________________________________________
consensus AGAGAGGGCCAGAGAAGAAGAAACGAGGCAGCCAGCCAGCAGGTGGCAATCATTTTTCTT