Previous Contig 005233:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011G03Sequence399005233 (3)pir|H84758|H847582e-27hypothetical protein At2g34620 [imported] - Arabidopsis thaliana>gb:AC004077_153745009065 (5)gb:BT004632_16376664e-93Arabidopsis thaliana At1g51540 gene, complete cds.
JMSF025N17Sequence626005233 (3)pir|H84758|H847582e-78hypothetical protein At2g34620 [imported] - Arabidopsis thaliana>gb:AC004077_153688005233 (3)gb:BT003819_16369504e-71Arabidopsis thaliana clone RAFL15-13-E10 (R20527) unknown protein (At2g34620) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025N17- ACCTATCTATCTGCAATT
                      ____________________________________________________________
consensus ACCTATCTATCTGCAATT
 
. : . : . : . : . : . :
rJMSF025N17- CCCAATGATGAAAAAATATAGCTTTACTGTTGATCACATTACATTGTTGTAGCAAAAGCA
                      ____________________________________________________________
consensus CCCAATGATGAAAAAATATAGCTTTACTGTTGATCACATTACATTGTTGTAGCAAAAGCA
 
. : . : . : . : . : . :
rJMSF025N17- GGGATTTATACAGAGATTTGGGCATTTAGATCAGTTGAAACTATCGTGTTCGTCTTCGTC
                      ____________________________________________________________
consensus GGGATTTATACAGAGATTTGGGCATTTAGATCAGTTGAAACTATCGTGTTCGTCTTCGTC
 
. : . : . : . : . : . :
rJMSF025N17- CATCACCTTGCAGCTTTATCAATTCCCAGAACTCTTCATCACTAGTCTTGAGCAAGAAGG
                      ____________________________________________________________
consensus CATCACCTTGCAGCTTTATCAATTCCCAGAACTCTTCATCACTAGTCTTGAGCAAGAAGG
 
. : . : . : . : . : . :
rJMSF025N17- GCAAAGGAAGATGAACACCCCTTCTCACAGCCTCCATATGCCTGGGTTTAATCCGATTCT
                      ____________________________________________________________
consensus GCAAAGGAAGATGAACACCCCTTCTCACAGCCTCCATATGCCTGGGTTTAATCCGATTCT
 
. : . : . : . : . : . :
rJMSF025N17- CCAAGCTGAAACTGAAGTACTGAGGAAACTCTTTCAACTCTTCCAACTTCCCCTCCATTT
JMSF025N17+ TCTTCCAACTTCCCCTCCATTT
                      ____________________________________________________________
consensus CCAAGCTGAAACTGAAGTACTGAGGAAACTCTTTCAACTCTTCCAACTTCCCCTCCATTT
 
. : . : . : . : . : . :
rJMSF025N17- CATTGGCAAAGTAGTGAAATTTGGGCTTGAAATTGTTGTCAATGCTGAAAGTGAACAGCC
JMSF025N17+ CATTGGCAAAGTAGTGAAATTTGGGCTTGAAATTGTTGTCAATGCTGAAAGTGAACAGCC
                      ____________________________________________________________
consensus CATTGGCAAAGTAGTGAAATTTGGGCTTGAAATTGTTGTCAATGCTGAAAGTGAACAGCC
 
. : . : . : . : . : . :
rJMSF025N17- CCGGGCACCTCAAAACCATCCCCACAGCATCAGTTCTTGAAAACCCCAAGCTGACCAGAT
JMSF025N17+ CCGGGCACCTCAAAACCATCCCCACAGCATCAGTTCTTGAAAACCCCAAGCTGACCAGAT
                      ____________________________________________________________
consensus CCGGGCACCTCAAAACCATCCCCACAGCATCAGTTCTTGAAAACCCCAAGCTGACCAGAT
 
. : . : . : . : . : . :
rJMSF025N17- AGTTGAGCTTAGGAATCAGTGTGTTCTCCACGCTGGAAACCAAGAGAATGGGGTCTTGAT
JMSF025N17+ AGTTGAGCTTAGGAATCAGTGTGTTCTCCACGCTGGAAACCAAGAGAATGGGGTCTTGAT
                      ____________________________________________________________
consensus AGTTGAGCTTAGGAATCAGTGTGTTCTCCACGCTGGAAACCAAGAGAATGGGGTCTTGAT
 
. : . : . : . : . : . :
rJMSF025N17- AAGCCAGGGAATGCAGATCTCTGAACCCAAGTCTCTGGAGATAGAACAAGGCAGGTTTGA
JMSF025N17+ AAGCCAGGGAATGCAGATCTCTGAACCCAAGTCTCTGGAGATAGAACAAGGCAGGTTTGA
                      ____________________________________________________________
consensus AAGCCAGGGAATGCAGATCTCTGAACCCAAGTCTCTGGAGATAGAACAAGGCAGGTTTGA
 
. : . : . : . : . : . :
rJMSF025N17- GCTGGTCTGGGACACTGGAAATGAGCAATCTTGGGCATTTGTTGATCACTTTCCTGAAGT
JMSF025N17+ GCTGGTCTGGGACACTGGAAATGAGCAATCTTGGGCATTTGTTGATCACTTTCCTGAAGT
                      ____________________________________________________________
consensus GCTGGTCTGGGACACTGGAAATGAGCAATCTTGGGCATTTGTTGATCACTTTCCTGAAGT
 
. : . : . : . : . : . :
rJMSF025N17- CATTGTCTGGGACATTAAGGTCTGAGGAGAGGAAAGTGAAGACAGGGATAAGGTGAGATT
JMSF025N17+ CATTGTCTGGGACATTAAGGTCTGAGGAGAGGAAAGTGAAGACAGGGATAAGGTGAGATT
JMSF011G03+ CTGAGGAGAGGAAAGTGAAGACAGGGATAAGGTGAGATT
                      ____________________________________________________________
consensus CATTGTCTGGGACATTAAGGTCTGAGGAGAGGAAAGTGAAGACAGGGATAAGGTGAGATT
 
. : . : . : . : . : . :
rJMSF025N17- TGATGTCTGA
JMSF025N17+ TGATGTCTGAGGTTAGGATGTTGGGGCACATTCCTATGATTCTCCCCAGGTCTTTCTGGT
JMSF011G03+ TGATGTCTGAGGTTAGGATGTTGGGGCACATTCCTATGATTCTCCCCAGGTCTTTCTGGT
                      ____________________________________________________________
consensus TGATGTCTGAGGTTAGGATGTTGGGGCACATTCCTATGATTCTCCCCAGGTCTTTCTGGT
 
. : . : . : . : . : . :
JMSF025N17+ GGATGCCTTTGGACTGCAAGAAAGTGATGATGGAGTGGATGGAGTGAAGGGGGGCTGTGT
JMSF011G03+ GGATGCCTTTGGACTGCAAGAAAGTGATGATGGAGTGGATGGAGTGAAGGGGGGCTGTGT
                      ____________________________________________________________
consensus GGATGCCTTTGGACTGCAAGAAAGTGATGATGGAGTGGATGGAGTGAAGGGGGGCTGTGT
 
. : . : . : . : . : . :
JMSF025N17+ GGAGAGAGGGGTTCTGGGAGAGGGCTCTCCCAGAATCAACACCCATGATTTCTAGGGACA
JMSF011G03+ GGAGAGAGGGGTTCTGGGAGAGGGCTCTCCCAGAATCAACACCCATGATTTCTAGGGACA
                      ____________________________________________________________
consensus GGAGAGAGGGGTTCTGGGAGAGGGCTCTCCCAGAATCAACACCCATGATTTCTAGGGACA
 
. : . : . : . : . : . :
JMSF025N17+ GGATTTTCTCCTTGAACTGGTGGGAGATGTTCTTGTGGGTTGGTTGGTAGAGTGGGTGTT
JMSF011G03+ GGATTTTCTCCTTGAACTGGTGGGAGATGTTCTTGTGGGTTGGTTGGTAGAGTGGGTGTT
                      ____________________________________________________________
consensus GGATTTTCTCCTTGAACTGGTGGGAGATGTTCTTGTGGGTTGGTTGGTAGAGTGGGTGTT
 
. : . : . : . : . : . :
JMSF025N17+ TG
JMSF011G03+ TGTGGAGGAGAGTTTTGGGTTTTGAGGATAAGAGGTTATTGTTATTGTTGTTGTTGGATA
                      ____________________________________________________________
consensus TGTGGAGGAGAGTTTTGGGTTTTGAGGATAAGAGGTTATTGTTATTGTTGTTGTTGGATA
 
. : . : . : . : . : . :
JMSF011G03+ GGTGGTCTGAGGAGCATGAAGAGAAACAACAATAGAAGGCTGTTGCTGACATTTTCTTTC
                      ____________________________________________________________
consensus GGTGGTCTGAGGAGCATGAAGAGAAACAACAATAGAAGGCTGTTGCTGACATTTTCTTTC