Previous Contig 005231:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009I18Sequence549005231 (2)gb:AB051809_15211488e-78Solanum tuberosum RiCDPK2 mRNA for calcium dependent protein kinase, complete cd745012719 (3)gb:AY394009_16047515e-49Vitis labrusca x Vitis vinifera calcium-dependent protein kinase (VCPK1) mRNA, c
JMSF011F22Sequence393005231 (2)gb:AY753552_16269062e-16Vicia faba calcium-dependent protein kinase 1 (CPK1) mRNA, complete cds.264012719 (3)gb:AY394009_16047519e-13Vitis labrusca x Vitis vinifera calcium-dependent protein kinase (VCPK1) mRNA, c

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF009I18+ AAGGAACAAAAAGTTCTCGGGCTTGAGATCTCTA
                      ____________________________________________________________
consensus AAGGAACAAAAAGTTCTCGGGCTTGAGATCTCTA
 
. : . : . : . : . : . :
JMFF009I18+ TGCATGACACCCAGGGAATGGCAAGCCTCCACGACCCCAACAATGGTCTTGAGCAGCTTA
                      ____________________________________________________________
consensus TGCATGACACCCAGGGAATGGCAAGCCTCCACGACCCCAACAATGGTCTTGAGCAGCTTA
 
. : . : . : . : . : . :
JMFF009I18+ GCAGCCTCCCTTTCACTGTAATGCCCCTTCTCCACAATCCTATCAAAGAGCTCCCCACCA
                      ____________________________________________________________
consensus GCAGCCTCCCTTTCACTGTAATGCCCCTTCTCCACAATCCTATCAAAGAGCTCCCCACCA
 
. : . : . : . : . : . :
JMFF009I18+ GCGCAGAGCTCCATGACTATATGCACATACAGGGCATCCTCAAAAGTACCCTTTATCCTC
                      ____________________________________________________________
consensus GCGCAGAGCTCCATGACTATATGCACATACAGGGCATCCTCAAAAGTACCCTTTATCCTC
 
. : . : . : . : . : . :
JMFF009I18+ ACAACATTCGGGTGCTCAGACAAGTGGTGCATTATCTGAATCTCCCGCCACACATCCTCG
                      ____________________________________________________________
consensus ACAACATTCGGGTGCTCAGACAAGTGGTGCATTATCTGAATCTCCCGCCACACATCCTCG
 
. : . : . : . : . : . :
JMFF009I18+ TAGTCCTCCTTGCAGATCAGCTTCTTCTTGGGAATGGTCTTGCAAGCATAGAGCGTGGCC
JMSF011F22+ TTGGGAATGGTCNTGCAAGCATAGAGCGTGGCC
                      ____________________________________________________________
consensus TAGTCCTCCTTGCAGATCAGCTTCTTCTTGGGAATGGTCTTGCAAGCATAGAGCGTGGCC
 
. : . : . : . : . : . :
JMFF009I18+ GTGGCCTTCTCCGTGCAGAGATGGGTGGTCCCAAACTGGCCTTGACCCAGCTTCTTGCCT
JMSF011F22+ GTGGCCTTCTCCGTGCAGAGATGGGTGGTCCCAAACTGGCCTTGACCCAGCTTCTTGCCT
                      ____________________________________________________________
consensus GTGGCCTTCTCCGTGCAGAGATGGGTGGTCCCAAACTGGCCTTGACCCAGCTTCTTGCCT
 
. : . : . : . : . : . :
JMFF009I18+ ATGGTGTAGAGGTGCCGAAGGGGCTGGGTCCTGTAAGGGAGGACCCATGTGGGCTTTGGC
JMSF011F22+ ATGGTGTAGAGGTGCCGAAGGGGCTGGGTCCTGTAAGGGAGGACCCATGTGGGCTTTGGC
                      ____________________________________________________________
consensus ATGGTGTAGAGGTGCCGAAGGGGCTGGGTCCTGTAAGGGAGGACCCATGTGGGCTTTGGC
 
. : . : . : . : . : . :
JMFF009I18+ CTTGGAGGGTCTGTTGTTGATGTTTCTGAGGTTGAGGACGCCATGGACGAGTGAATGAAT
JMSF011F22+ CTTGGAGGGTCTGTTGTTGATGTTTCTGAGGTTGAGGACGCCATGGACGAGTGAATGAAT
                      ____________________________________________________________
consensus CTTGGAGGGTCTGTTGTTGATGTTTCTGAGGTTGAGGACGCCATGGACGAGTGAATGAAT
 
. : . : . : . : . : . :
JMFF009I18+ CCTGAATTCGTGACTCAATAAGCAGTGAATTCAAT
JMSF011F22+ CCTGAATTCGTGACTCAATAAGCAGTGAATTCAATGGATTTGAGATTAAAATTTGGGGGT
                      ____________________________________________________________
consensus CCTGAATTCGTGACTCAATAAGCAGTGAATTCAATGGATTTGAGATTAAAATTTGGGGGT
 
. : . : . : . : . : . :
JMSF011F22+ ATTAAATTGAAGAATAGACTTGGAGAAAAGTTGTCAGTAACCAAGACTTCTGTTTCCTCT
                      ____________________________________________________________
consensus ATTAAATTGAAGAATAGACTTGGAGAAAAGTTGTCAGTAACCAAGACTTCTGTTTCCTCT
 
. : . : . : . : . : . :
JMSF011F22+ CACTTTCTCTCTCCGTTTCTTGCACGAGAGTTTCTCTTTCTATATTCGCTCCAATTCCGC
                      ____________________________________________________________
consensus CACTTTCTCTCTCCGTTTCTTGCACGAGAGTTTCTCTTTCTATATTCGCTCCAATTCCGC