Previous Contig 005225:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005P18Sequence275005225 (4)gb:AY622222_16183743e-11Ipomoea batatas protein disulfide isomerase mRNA, complete cds.
JMSF007M14Sequence360005225 (4)gb:AY622222_16183742e-27Ipomoea batatas protein disulfide isomerase mRNA, complete cds.791011401 (2)gb:AY622222_16183743e-86Ipomoea batatas protein disulfide isomerase mRNA, complete cds.
JMSF011E12Sequence359005225 (4)gb:AY622222_16183749e-26Ipomoea batatas protein disulfide isomerase mRNA, complete cds.746011401 (2)gb:AY622222_16183743e-80Ipomoea batatas protein disulfide isomerase mRNA, complete cds.
JMSF046H01Sequence716005225 (4)gb:AY622222_16183742e-81Ipomoea batatas protein disulfide isomerase mRNA, complete cds.785024210gb:AY622222_16183748e-40Ipomoea batatas protein disulfide isomerase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046H01+ ACTGGTTCGCCCCGGGGGAGGTGTTTAGCGTCAAGTGTATGAGCAAAATCATAATCAGC
                      ____________________________________________________________
consensus ACTGGTTCGCCCCGGGGGAGGTGTTTAGCGTCAAGTGTATGAGCAAAATCATAATCAGC
 
. : . : . : . : . : . :
JMSF046H01+ TCGGAGTTTTTCAGCTAGAGTTATGAAGTTTTCAAATTCTGCCCCAGAAAATTTTGGAAA
                      ____________________________________________________________
consensus TCGGAGTTTTTCAGCTAGAGTTATGAAGTTTTCAAATTCTGCCCCAGAAAATTTTGGAAA
 
. : . : . : . : . : . :
JMSF046H01+ TACACCAGCAACAAATATCTTTTTCTCATCAATTAGAGAAGAAGCATCTTCCCTGGACTG
                      ____________________________________________________________
consensus TACACCAGCAACAAATATCTTTTTCTCATCAATTAGAGAAGAAGCATCTTCCCTGGACTG
 
. : . : . : . : . : . :
JMSF046H01+ GATTTCAGTTGATGCAGGACCAGCTTGTTTCTTCAAATAAGTAACTATACCATCTGCTTC
                      ____________________________________________________________
consensus GATTTCAGTTGATGCAGGACCAGCTTGTTTCTTCAAATAAGTAACTATACCATCTGCTTC
 
. : . : . : . : . : . :
JMSF046H01+ ACGAGGGCCTTTATAATCTTGAACCTTGTTTCCTCCATCACGTAAGATCTTAATGGATGG
                      ____________________________________________________________
consensus ACGAGGGCCTTTATAATCTTGAACCTTGTTTCCTCCATCACGTAAGATCTTAATGGATGG
 
. : . : . : . : . : . :
JMSF007M14+ TCAAC
JMSF046H01+ GAAACCTTGGACCCGGTATTTGGTGGAAAGTTCTTTGTTTACTTCATCACTGGCGTCAAC
                      ____________________________________________________________
consensus GAAACCTTGGACCCGGTATTTGGTGGAAAGTTCTTTGTTTACTTCATCACTGGCGTCAAC
 
. : . : . : . : . : . :
JMSF007M14+ TTTTGCAAGAGTGATNGGAGGGTCATGACTACTCAAAATGGATGCAGCTTTTTCATACTC
JMSF046H01+ TTTTGCAAGAGTGATTGGAGGGTCATGACTACTCAAAATGGATGCAGCTTTTTCATACTC
JMSF011E12+ TTTGCAAGAGTGATNGGAGGGTCATGACTACTCAAAATGGATGCAGCTTTTTCATACTC
                      ____________________________________________________________
consensus TTTTGCAAGAGTGATTGGAGGGTCATGACTACTCAAAATGGATGCAGCTTTTTCATACTC
 
. : . : . : . : . : . :
JMSF007M14+ TGGAGCAAGTCTCTTACAGTGTCCGCACCAAGGGGCGTAGAACTCGACGACGATGAAATT
JMSF005P18+ TGTCCGCACCAAGGGGCGTAGAACTCGACGACGATGAAATT
JMSF046H01+ TGGAGCAAGTCTCTTACAGTGTCCGCACCAAGGGGCGTAGAACTCGACGACGATGAAATT
JMSF011E12+ TGGAGCAAGTCTCTTACAGTGTCCGCACCAAGGGGCGTAGAACTCGACGACGATGAAATT
                      ____________________________________________________________
consensus TGGAGCAAGTCTCTTACAGTGTCCGCACCAAGGGGCGTAGAACTCGACGACGATGAAATT
 
. : . : . : . : . : . :
JMSF007M14+ GTGTTTGGCCACCGTGTCGGAGAAGTTAGTATGGTCCAAAGTCAGCACGTATTCTTTCTC
JMSF005P18+ GTGTTTGGCCACCGTGTCGGAGAAGTTAGTATGGTCCAAAGTCAGCACGTATTCTTTCTC
JMSF046H01+ GTGTTTGGCCACCGTGTCGGAGAAGTTAGTATGGTCCAAAGTCAGCACGTATTCTTTCTC
JMSF011E12+ GTGTTTGGCCACCGTGTCGGAGAAGTTAGTATGGTCCAAAGTCAGCACGTATTCTTTCTC
                      ____________________________________________________________
consensus GTGTTTGGCCACCGTGTCGGAGAAGTTAGTATGGTCCAAAGTCAGCACGTATTCTTTCTC
 
. : . : . : . : . : . :
JMSF007M14+ CTCCGCCTCCACCTCGGCGGTTGCTGCGGCGGCGAAGAGCGCCGCCAGAATTACGAAAAT
JMSF005P18+ CTCCGCCTCCACCTCGGCGGTTGCTGCGGCGGCGAAGAGCGCCGCCAGAATTACGAAAAT
JMSF046H01+ CTCCGCCTCCACCTCGGCGGTTGCTGCGGCGGCGAAGAGCGCCGCCAGAATTACGAAAAT
JMSF011E12+ CTCCGCCTCCACCTCGGCGGTTGCTGCGGCGGCGAAGAGCGCCGCCAGAATTACGAAAAT
                      ____________________________________________________________
consensus CTCCGCCTCCACCTCGGCGGTTGCTGCGGCGGCGAAGAGCGCCGCCAGAATTACGAAAAT
 
. : . : . : . : . : . :
JMSF007M14+ GCCAAGGAAAGCTCTCCTCCGCGACATGGTCAAACAGCAGAAGCTGTGTGTCCGAAACAG
JMSF005P18+ GCCAAGGAAAGCTCTCCTCCGCGACATGGTCAAACAGCAGAAGCTGTGTGTCCGAAACAG
JMSF046H01+ GCCAAGGAAAGCTCTCCTCCGCGACATGGTCAAACAGCAGAAGCTGTGTGTCCGAAACAG
JMSF011E12+ GCCAAGGAAAGCTCTCCTCCGCGACATGGTCAAACAGCAGAAGCTGTGTGTCCGAAACAG
                      ____________________________________________________________
consensus GCCAAGGAAAGCTCTCCTCCGCGACATGGTCAAACAGCAGAAGCTGTGTGTCCGAAACAG
 
. : . : . : . : . : . :
JMSF007M14+ GGTACTGAGAAGTAGATGAGAAATGGAAACGAGACGAGCGGAGTGGGAAGC
JMSF005P18+ GGTACTGAGAAGTAGATGAGAAATGGAAACGAGACGAGCGGAGTGGGAAGC
JMSF046H01+ GGTACTGAGAAGTAGATGAGAAATGGAAACGAGACGAGCGGAGTGGGAAGC
JMSF011E12+ GGTACTGAGAAGTAGATGAGAAATGGAAACGAGACGAGCGGAGTGGGAAGCGCAATAAGC
                      ____________________________________________________________
consensus GGTACTGAGAAGTAGATGAGAAATGGAAACGAGACGAGCGGAGTGGGAAGCGCAATAAGC