Previous Contig 005215:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006B21Sequence542005215 (6)gb:AY094010_15755161e-50Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.709010108 (7)gb:AY094010_15755167e-98Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.
JMFF015B05Sequence494005215 (6)gb:AY094010_15755163e-41Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.352010108 (7)gb:AY094010_15755165e-32Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.
JMFF041C08Sequence634005215 (6)gb:AY094010_15755168e-67Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.602010108 (7)gb:AY094010_15755164e-72Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.
JMFF043G06Sequence645005215 (6)gb:AY094010_15755166e-69Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.537010108 (7)gb:AY094010_15755162e-60Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.
JMSF008F14Sequence439005215 (6)gb:AY094010_15755169e-50Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.762010108 (7)gb:AY094010_1575516e-114Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.
JMSF011D09Sequence302005215 (6)gb:AY094010_15755161e-13Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.812010108 (7)gb:AY094010_1575516e-121Arabidopsis thaliana At1g12050/F12F1_8 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043G06+ GCCAGATACTACAATGNATGATGCTCGTCCATGATACGCAATAGGAAGATGGAACCAATT
JMFF041C08+ ATGATGCTCGTCCATGATACGCAATAGGAAGATGGAACCAATT
                      ____________________________________________________________
consensus GCCAGATACTACAATGNATGATGCTCGTCCATGATACGCAATAGGAAGATGGAACCAATT
 
. : . : . : . : . : . :
JMFF043G06+ ACGGTTGATTGGGTTCTCTGGGCCTCGAAATATGGTTCCACAATTCTTTGCATGATGCAT
JMFF041C08+ ACGGTTGATTGGGTTCTCTGGGCCTCGAAATATGGTTCCACAATTCTNTGCATGATGCAT
JMSF008F14+ CATGATGCAT
JMFF006B21+ CATGATGCAT
                      ____________________________________________________________
consensus ACGGTTGATTGGGTTCTCTGGGCCTCGAAATATGGTTCCACAATTCTTTGCATGATGCAT
 
. : . : . : . : . : . :
JMFF043G06+ GGATGAAAAGAAGTCTGTGTAATCACCAATTGCAATAGGGAGAATCATTTCCACCTTGTC
JMFF041C08+ GGATGAAAAGAAGTCTGTGTAATCACCAATTGCAATAGGGAGAATCATTTCCACCTTGTC
JMFF015B05+ AATAGGGAGAATCATTTCCACCTTGTC
JMSF008F14+ GGATGAAAAGAAGTCTGTGTAATCACCAATTGCAATAGGGAGAATCATTTCCACCTTGTC
JMFF006B21+ GGATGAAAAGAAGTCTGTGTAATCACCAATTGCAATAGGGAGAATCATTTCCACCTTGTC
                      ____________________________________________________________
consensus GGATGAAAAGAAGTCTGTGTAATCACCAATTGCAATAGGGAGAATCATTTCCACCTTGTC
 
. : . : . : . : . : . :
JMFF043G06+ CATGGGGATAAGAGCTTTCTGCCGTAAACTTGCATTGTCACGCAATTTTGGCTCAGTAGC
JMFF041C08+ CATGGGGATAAGAGCTTTCTGCCGTAAACTTGCATTGTCACGCAATTTTGGCTCAGTAGC
JMFF015B05+ CATGGGGATAAGAGCTTTCTGCCGTAAACTTGCATTGTCACGCAATTTTGGCTCAGTAGC
JMSF008F14+ CATGGGGATAAGAGCTTTCTGCCGTAAACTTGCATTGTCACGCAATTTTGGCTCAGTAGC
JMFF006B21+ CATGGGGATAAGAGCTTTCTGCCGTAAACTTGCATTGTCACGCAATTTTGGCTCAGTAGC
                      ____________________________________________________________
consensus CATGGGGATAAGAGCTTTCTGCCGTAAACTTGCATTGTCACGCAATTTTGGCTCAGTAGC
 
. : . : . : . : . : . :
JMFF043G06+ TGATAGTAGCTTTTGTAGTGTTTCACGAGCTTCCTTCCATGCAGGCCGTCCCAAATGCAA
JMFF041C08+ TGATAGTAGCTTTTGTAGTGTTTCACGAGCTTCCTTCCATGCAGGCCGTCCCAAATGCAA
JMFF015B05+ TGATAGTAGCTTTTGTAGTGTTTCACGAGCTTCCTTCCATGCAGGCCGTCCCAAATGCAA
JMSF008F14+ TGATAGTAGCTTTTGTAGTGTTTCACGAGCTTCCTTCCATGCAGGCCGTCCCAAATGCAA
JMFF006B21+ TGATAGTAGCTTTTGTAGTGTTTCACGAGCTTCCTTCCATGCAGGCCGTCCCAAATGCAA
                      ____________________________________________________________
consensus TGATAGTAGCTTTTGTAGTGTTTCACGAGCTTCCTTCCATGCAGGCCGTCCCAAATGCAA
 
. : . : . : . : . : . :
JMFF043G06+ AAATTTGTTAAGATTAGGCTGAGTGAAGCAATCGGAGTTCCGCAAACACGGACCATCAAA
JMFF041C08+ AAATTTGTTAAGATTAGGCTGAGTGAAGCAATCGGAGTTCCGCAAACACGGACCATCAAA
JMFF015B05+ AAATTTGTTAAGATTAGGCTGAGTGAAGCAATCGGAGTTCCGCAAACACGGACCATCAAA
JMSF008F14+ AAATTTGTTAAGATTAGGCTGAGTGAAGCAATCGGAGTTCCGCAAACACGGACCATCAAA
JMFF006B21+ AAATTTGTTAAGATTAGGCTGAGTGAAGCAATCGGAGTTCCGCAAACACGGACCATCAAA
JMSF011D09+ AA
                      ____________________________________________________________
consensus AAATTTGTTAAGATTAGGCTGAGTGAAGCAATCGGAGTTCCGCAAACACGGACCATCAAA
 
. : . : . : . : . : . :
JMFF043G06+ GAGACCGGCAGCGGCGATCACAGAGAGATCGGCAACGTAGTCGCCGATAGCGACGCCCGG
JMFF041C08+ GAGACCGGCAGCGGCGATCACAGAGAGATCGGCAACGTAGTCGCCGATAGCGACGCCCGG
JMFF015B05+ GAGACCGGCAGCGGCGATCACAGAGAGATCGGCAACGTAGTCGCCGATAGCGACGCCCGG
JMSF008F14+ GAGACCGGCAGCGGCGATCACAGAGAGATCGGCAACGTAGTCGCCGATAGCGACGCCCGG
JMFF006B21+ GAGACCGGCAGCGGCGATCACAGAGAGATCGGCAACGTAGTCGCCGATAGCGACGCCCGG
JMSF011D09+ GAGACCGGCAGCGGCGATCACAGAGAGATCGGCAACGTAGTCGCCGATAGCGACGCCCGG
                      ____________________________________________________________
consensus GAGACCGGCAGCGGCGATCACAGAGAGATCGGCAACGTAGTCGCCGATAGCGACGCCCGG
 
. : . : . : . : . : . :
JMFF043G06+ TCGAGCATCGGAACCGGGTTCGGGCTTGAAAACGCCGAAGGGGAGATTCTCGAGCGGGAA
JMFF041C08+ TCGAGCATCGGAACCGGGTTCGGGCTTGAAAACGCCGAAGGGGAGATTCTCGAGCGGGAA
JMFF015B05+ TCGAGCATCGGAACCGGGTTCGGGCTTGAAAACGCCGAAGGGGAGATTCTCGAGCGGGAA
JMSF008F14+ TCGAGCATCGGAACCGGGTTCGGGCTTGAAAACGCCGAAGGGGAGATTCTCGAGCGGGAA
JMFF006B21+ TCGAGCATCGGAACCGGGTTCGGGCTTGAAAACGCCGAAGGGGAGATTCTCGAGCGGGAA
JMSF011D09+ TCGAGCATCGGAACCGGGTTCGGGCTTGAAAACGCCGAAGGGGAGATTCTCGAGCGGGAA
                      ____________________________________________________________
consensus TCGAGCATCGGAACCGGGTTCGGGCTTGAAAACGCCGAAGGGGAGATTCTCGAGCGGGAA
 
. : . : . : . : . : . :
JMFF043G06+ GTGGGAGTCGGACTTGACTTCGAGGAATGATTTCAGGCCCATGATACGGCGTCGTAGCAG
JMFF041C08+ GTGGGAGTCGGACTTGACTTCGAGGAATGATTTCAGGCCCATGATACGGCGTCGTAGCAG
JMFF015B05+ GTGGGAGTCGGACTTGACTTCGAGGAATGATTTCAGGCCCATGATACGGCGTCGTAGCAG
JMSF008F14+ GTGGGAGTCGGACTTGACTTCGAGGAATGATTTCAGGCCCATGATACGGCGTCGTAGCAG
JMFF006B21+ GTGGGAGTCGGACTTGACTTCGAGGAATGATTTCAGGCCCATGATACGGCGTCGTAGCAG
JMSF011D09+ GTGGGAGTCGGACTTGACTTCGAGGAATGATTTCAGGCCCATGATACGGCGTCGTAGCAG
                      ____________________________________________________________
consensus GTGGGAGTCGGACTTGACTTCGAGGAATGATTTCAGGCCCATGATACGGCGTCGTAGCAG
 
. : . : . : . : . : . :
JMFF043G06+ GCTCCGGTGAGTCGTCGGGAAGGCAAATGCCGGGATTTTGGATAGAGTTAAATAGAGGGA
JMFF041C08+ GCTCCGGTGAGTCGTCGGGAAGGCAAATGCCGGGATTTTGGATAGAGTTAAATAGAGGGA
JMFF015B05+ GCTCCGGTGAGTCGTCGGGAAGGCAAATGCCGGGATTTTGGATAGAGTTAAATAGAGGGA
JMSF008F14+ GCTCC
JMFF006B21+ GCTCCGGTGAGTCGTCGGGAAGGCAAATGCCGGGATTTTGGATAGAGTTAAATAGAGGGA
JMSF011D09+ GCTCCGGTGAGTCGTCGGGAAGGCAAATGCCGGGATTTTGGATAGAGTTAAATAGAGGGA
                      ____________________________________________________________
consensus GCTCCGGTGAGTCGTCGGGAAGGCAAATGCCGGGATTTTGGATAGAGTTAAATAGAGGGA
 
. : . : . : . : . : . :
JMFF043G06+ GTAGCCAGCACGGAAGCTGGAGTGACTCACTATCTTTCCCTTCTT
JMFF041C08+ GTAGCCAGCACGGAAGCTGGAGTGACTCACTATCTTTCCCTTCTT
JMFF015B05+ GTAGCCAGCACGGAAGCTGGAGTGACTCACTATCTTTCCCTTCTT
JMFF006B21+ GTAGCCAGCACGGAAGCTGGAGTGACTCACTATCTTTCCCTTCTT
JMSF011D09+ GTAGCCAGCACGGAAGCTGGAGTGACTCACTATCTTTCCCTTCTTAGTAACGTAACTCTC
                      ____________________________________________________________
consensus GTAGCCAGCACGGAAGCTGGAGTGACTCACTATCTTTCCCTTCTTAGTAACGTAACTCTC