Previous Contig 005213:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010L04Sequence620005213 (9)gb:AP004028_18365871e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11808008987 (8)gb:AC006569_15344642e-59Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMFF016E09Sequence546005213 (9)gb:AP004028_18365874e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11717008987 (8)gb:AC006569_15344641e-28Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMFF016E10Sequence550005213 (9)gb:AP004028_18365877e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11778008987 (8)gb:AC006569_15344644e-43Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMFF017B05Sequence594005213 (9)gb:AP004028_18365873e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11781008987 (8)gb:AC006569_15344645e-29Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMSF001A21Sequence270005213 (9)gb:AC006569_15344649e-13Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A670008987 (8)gb:AC006569_15344643e-29Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMSF011C08Sequence265005213 (9)gb:AC006569_15344640.001Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A784008987 (8)gb:AC006569_15344648e-61Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMSF026D02Sequence664005213 (9)gb:AP004028_18365871e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11719008987 (8)gb:AC006569_15344645e-33Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMSF029N06Sequence632005213 (9)gb:AP004028_18365873e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11710023412gb:AC006569_15344641e-29Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A
JMSF040O20Sequence675005213 (9)gb:AP004028_18365871e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11755008987 (8)gb:AC006569_15344643e-65Arabidopsis thaliana chromosome 2 clone F11A3 map mi148, complete sequence.>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040O20+ CCTCGGGAATTTCTTGTATAATAGCTTCNTCAGCTGCAGCTTTAGCCC
                      ____________________________________________________________
consensus CCTCGGGAATTTCTTGTATAATAGCTTCNTCAGCTGCAGCTTTAGCCC
 
. : . : . : . : . : . :
JMFF017B05+ ATAAATCTCA
JMFF010L04+ CATTCTGGATGGGGATGTTGGAGATGCCCCCAAACTTGAAAGCTGTATAAATCTCA
JMSF029N06+ GCATTCTGGATGGGGATGTTGGAGATGCCCCCAAACTTGAAAGCTGTATAAATCTCA
JMSF040O20+ TAAGCATTCTGGATGGGGATGTTGGAGATGCCCCCAAACTTGAAAGCTGTATAAATCTCA
JMSF026D02+ GCATTCTGGATGGGGATGTTGGAGATGCCCCCAAACTTGAAAGCTGTATAAATCTCA
                      ____________________________________________________________
consensus TAAGCATTCTGGATGGGGATGTTGGAGATGCCCCCAAACTTGAAAGCTGTATAAATCTCA
 
. : . : . : . : . : . :
JMFF017B05+ AAATTCCACCGTGTTCTTTGGCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
JMFF010L04+ AAATTCCACCGTGTTCTTTGGCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
JMSF029N06+ AAATTCCACCGTGTTCTTTGGCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
JMFF016E10+ TTTGGCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
JMFF016E09+ GCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
JMSF040O20+ AAATTCCACCGTGTTCTTTGGCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
JMSF026D02+ AAATTCCACCGTGTTCTTTGGCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
                      ____________________________________________________________
consensus AAATTCCACCGTGTTCTTTGGCAATTGAAGCAAGCTGTTTAGCCATATAGTGGTTGACTT
 
. : . : . : . : . : . :
JMFF017B05+ CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
JMFF010L04+ CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
JMSF029N06+ CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
JMFF016E10+ CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
JMFF016E09+ CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
JMSF040O20+ CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
JMSF026D02+ CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
                      ____________________________________________________________
consensus CCTCAAAGCTGTAATTCCTTGTCTCGTACTCCCTTCCGATAAGATTGATAACAACATTAG
 
. : . : . : . : . : . :
JMFF017B05+ CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCACTGGAACAA
JMFF010L04+ CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCATTGGAACAA
JMSF029N06+ CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCATTGGAACAA
JMFF016E10+ CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCATTGGAACAA
JMFF016E09+ CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCATTGGAACAA
JMSF040O20+ CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCATTGGAACAA
JMSF026D02+ CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCATTGGAACAA
                      ____________________________________________________________
consensus CTTTTGCCATCACTGCTTTTATTGAATTTTCATCTCTGGGGTTGTATTTCATTGGAACAA
 
. : . : . : . : . : . :
JMFF017B05+ TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
JMFF010L04+ TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
JMSF029N06+ TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
JMFF016E10+ TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
JMFF016E09+ TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
JMSF040O20+ TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
JMSF026D02+ TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
                      ____________________________________________________________
consensus TCTGACCCAAATCACCCATTAACTTGAGATGACGATGACAATCTTCAGATCCTCGGAAAG
 
. : . : . : . : . : . :
JMFF017B05+ GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
JMFF010L04+ GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
JMSF029N06+ GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
JMFF016E10+ GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
JMSF001A21+ ATC
JMFF016E09+ GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
JMSF040O20+ GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
JMSF026D02+ GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
                      ____________________________________________________________
consensus GTACCAAAACTTGAGAACCCATTTTAGCAAGCTGCTGCACTAGGTACCGCCCAAGAAATC
 
. : . : . : . : . : . :
JMFF017B05+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMFF010L04+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMSF029N06+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMFF016E10+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMSF001A21+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMFF016E09+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMSF040O20+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMSF026D02+ CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
JMSF011C08+ ACAGATGATCTCCCTCCAGTTCCCT
                      ____________________________________________________________
consensus CTGTTGCCCCAAACACTGTAGCAACAATTCCACTCACAGATGATCTCCCTCCAGTTCCCT
 
. : . : . : . : . : . :
JMFF017B05+ TGCGAAC
JMFF010L04+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
JMSF029N06+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
JMFF016E10+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
JMSF001A21+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
JMFF016E09+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
JMSF040O20+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
JMSF026D02+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
JMSF011C08+ TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
                      ____________________________________________________________
consensus TGCGAACTATGTGTCCAGTGCCTTTGGCAGTGAGGGTCGATGCATAGCGCGGGGTTCCAA
 
. : . : . : . : . : . :
JMFF010L04+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
JMSF029N06+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
JMFF016E10+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
JMSF001A21+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
JMFF016E09+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
JMSF040O20+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
JMSF026D02+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
JMSF011C08+ TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
                      ____________________________________________________________
consensus TTCCATAGCATTGATCGGAGAGGAGATAGGAAGACTTGAGAGCTGAAATTGAAGGTGAAG
 
. : . : . : . : . : . :
JMFF010L04+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCGTCTGC
JMSF029N06+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCGTC
JMFF016E10+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCGTCTGC
JMSF001A21+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCATCTGC
JMFF016E09+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCGTCTGC
JMSF040O20+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCGTCTGC
JMSF026D02+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCACGTAACGGCCTGCATTGTTCTTCGTCTGC
JMSF011C08+ ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCGTCTGC
                      ____________________________________________________________
consensus ACGGGTTTAAAGATTGTTGCCCTAGACGCCTCGTAACGGCCTGCATTGTTCTTCGTCTGC
 
. : . : . : . : . : . :
JMFF010L04+ GCTGAGCTCTGGGAGAAAGCGATT
JMFF016E10+ GCTGAGCTCTGGGAGAAAGCGATTGC
JMSF001A21+ GCTGAGCTCTGGGAGAAAGCGATTG
JMFF016E09+ GCTGAGCTCTGGGAGAAAGCGATTGC
JMSF040O20+ GCTGAGCTCTGGGAGAAAGCGATTGC
JMSF026D02+ GCTGAGCTCTGGGAGAAAGCGATTGC
JMSF011C08+ GCTGAGCTCTGGGAGAAAGCGATTGCGAATTGCTGTTTGCTGCAAAGGCCTGTGAAAATC
                      ____________________________________________________________
consensus GCTGAGCTCTGGGAGAAAGCGATTGCGAATTGCTGTTTGCTGCAAAGGCCTGTGAAAATC