Previous Contig 005212:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038H15Sequence455005212 (3)gb:AP004839_18457911e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P051705011615 (3)gb:OSJN00022_16934475e-67Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011L07, complete seque
JMSF011C01Sequence331005212 (3)gb:AP004839_18457919e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P051760011615 (3)gb:AY374447_16034801e-61Zea mays fatty aldehyde dehydrogenase 1 gene, complete cds.
JMSF051L10Sequence678005212 (3)gb:AP004839_18457913e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P051787011615 (3)gb:OSJN00022_16934473e-64Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011L07, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051L10+ CCAGTTCCAAAGTGACAG
                      ____________________________________________________________
consensus CCAGTTCCAAAGTGACAG
 
. : . : . : . : . : . :
JMSF051L10+ GAGTCAGGTGCTTGGCGGCGGCAGTCATAATGAGGCGCCCCACCGCTGCACTGCCTGTGA
                      ____________________________________________________________
consensus GAGTCAGGTGCTTGGCGGCGGCAGTCATAATGAGGCGCCCCACCGCTGCACTGCCTGTGA
 
. : . : . : . : . : . :
JMSF051L10+ AGAAAATCTTGTCCCATTTATGCTCCAACAGCCTCTCAGCAACCAAACTCCCACCTTCAA
                      ____________________________________________________________
consensus AGAAAATCTTGTCCCATTTATGCTCCAACAGCCTCTCAGCAACCAAACTCCCACCTTCAA
 
. : . : . : . : . : . :
JMSF051L10+ TGACCTTAAAAGCTTTAGGGTCTAAATAAGCAGGAATAGACTTGGCTATCACTGATGAAC
                      ____________________________________________________________
consensus TGACCTTAAAAGCTTTAGGGTCTAAATAAGCAGGAATAGACTTGGCTATCACTGATGAAC
 
. : . : . : . : . : . :
JMFF038H15+ CTTAAGAACAGCAACACATCCTGCGGCTATAGCTCCGA
JMSF051L10+ ATGCCGGAGCCTGCTCTGACGGCTTAAGAACAGCAACACATCCTGCGGCTATAGCTCCGA
                      ____________________________________________________________
consensus ATGCCGGAGCCTGCTCTGACGGCTTAAGAACAGCAACACATCCTGCGGCTATAGCTCCGA
 
. : . : . : . : . : . :
JMFF038H15+ TGATGGGTTCCAATGCTAACCCAATAGGGAGATTCCAAGCTGAAAAAATGAGGACTAAAC
JMSF051L10+ TGATGGGTTCCAATGCTAACCCAATAGGGAGATTCCAAGCTGAAAAAATGAGGACTAAAC
                      ____________________________________________________________
consensus TGATGGGTTCCAATGCTAACCCAATAGGGAGATTCCAAGCTGAAAAAATGAGGACTAAAC
 
. : . : . : . : . : . :
JMFF038H15+ CCAGGGGTTCAGGAATTATCTCTGCTTTTGCAGGGAATGCAGCAATGGGTAGTTTGGCCT
JMSF051L10+ CCAGGGGTTCAGGAATTATCTCTGCTTTTGCAGGGAATGCAGCAATGGGTAGTTTGGCCT
JMSF011C01+ GCAGGGAATGCAGCAATGGGTAGTTTGGCCT
                      ____________________________________________________________
consensus CCAGGGGTTCAGGAATTATCTCTGCTTTTGCAGGGAATGCAGCAATGGGTAGTTTGGCCT
 
. : . : . : . : . : . :
JMFF038H15+ TTTTACCAGACATCCAGCCCTTTAAGCCTGCCATGGCAAACTCTATAGACTTTACAAGTG
JMSF051L10+ TTTTACCAGACATCCAGCCCTTTAAGCCTGCCATGGCAAACTCTATAGACTTTACAAGTG
JMSF011C01+ TTTTACCAGACATCCAGCCCTTTAAGCCTGCCATGGCAAACTCTATAGACTTTACAAGTG
                      ____________________________________________________________
consensus TTTTACCAGACATCCAGCCCTTTAAGCCTGCCATGGCAAACTCTATAGACTTTACAAGTG
 
. : . : . : . : . : . :
JMFF038H15+ GTCCAATCTCATCTCTGTAGGCTTCAACATGGTGTTTTCCCAGGTCTTGTTTGAGGGCCA
JMSF051L10+ GTCCAATCTCATCTCTGTAGGCTTCAACATGGTGTTTTCCCAGGTCTTGTTTGAGGGCCA
JMSF011C01+ GTCCAATCTCATCTCTGTAGGCTTCAACATGGTGTTTTCCCAGGTCTTGTTTGAGGGCCA
                      ____________________________________________________________
consensus GTCCAATCTCATCTCTGTAGGCTTCAACATGGTGTTTTCCCAGGTCTTGTTTGAGGGCCA
 
. : . : . : . : . : . :
JMFF038H15+ TGGAGATGTCATCTTCTTTCTCCTGAACCAGTCTGAGCAAAGCTTTCAGCTGGGACCTCC
JMSF051L10+ TGGAGATGTCATCTTCTTTCTCCTGAACCAGTCTGAGCAAAGCTTTCAGCTGGGACCTCC
JMSF011C01+ TGGAGATGTCATCTTCTTTCTCCTGAACCAGTCTGAGCAAAGCTTTCAGCTGGGACCTCC
                      ____________________________________________________________
consensus TGGAGATGTCATCTTCTTTCTCCTGAACCAGTCTGAGCAAAGCTTTCAGCTGGGACCTCC
 
. : . : . : . : . : . :
JMFF038H15+ TCCAAGATTCTTCCCTGGTTTTACCTGAACGGAATGTCTTCCTCAGCCCCTCCAAACTTG
JMSF051L10+ TCCAAGATTCTTCCCTGGTTTTACCTGAACGGAATGTCTTCCTCAGCCCCTCCAAACTTG
JMSF011C01+ TCCAAGATTCTTCCCTGGTTTTACCTGAACGGAATGTCTTCCTCAGCCCCTCCAAACTTG
                      ____________________________________________________________
consensus TCCAAGATTCTTCCCTGGTTTTACCTGAACGGAATGTCTTCCTCAGCCCCTCCAAACTTG
 
. : . : . : . : . : . :
JMFF038H15+ CTCCAAAATCTTCCATGGATGCTCTGCTTTCTAGCTGCTTTTTATTTTCGGTAT
JMSF051L10+ CTCCAAAATCTTCCATGGATGCTCTGCTTTCTAGCTGCTTTTTATTTTCTGTAT
JMSF011C01+ CTCCAAAATCTTCCATGGATGCTCTGCTTTCTAGCTGCTTTTTATTTTCTGTATTGTGTC
                      ____________________________________________________________
consensus CTCCAAAATCTTCCATGGATGCTCTGCTTTCTAGCTGCTTTTTATTTTCTGTATTGTGTC