Previous Contig 005211:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS070A10Sequence627005211 (3)gb:ATTRNASYA_15566831e-66A.thaliana tRNA synthetase.
JMFS071A12Sequence639005211 (3)sp|P36428|SYA_ARATH2e-75Alanyl-tRNA synthetase, mitochondrial precursor (EC 6.1.1.7) (Alanine--tRNA liga
JMSF011B24Sequence281005211 (3)748011614 (2)pir|D96538|D965383e-39cytosolic tRNA-Ala synthetase [imported] - Arabidopsis thaliana>gb:AE005173_8929

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS071A12+ AAGAAACTTGAGCCAGAGTTCTTTAGCCTCAGTGTCAGCTGGAAGACCAGAC
                      ____________________________________________________________
consensus AAGAAACTTGAGCCAGAGTTCTTTAGCCTCAGTGTCAGCTGGAAGACCAGAC
 
. : . : . : . : . : . :
JMFS071A12+ TTCTCATCGCCCCCAAAATAAGTGGCATAAAACCGATCAGCAGGCAGCTTATATACCTCT
JMFS070A10+ CCCCAAAATAAGTGGCATANAACCGATCAGCAGGCAGCTTATATACCTCT
                      ____________________________________________________________
consensus TTCTCATCGCCCCCAAAATAAGTGGCATAAAACCGATCAGCAGGCAGCTTATATACCTCT
 
. : . : . : . : . : . :
JMFS071A12+ GTGAGAAGTTCCCAAGCCCATTGAATGGCCTCTGTTTTGAAATAATCTCCGAAAGACCAA
JMFS070A10+ GTGAGAAGTTCCCAAGCCCATTGAATGGCCTCTGTTTTGAAATAATCTCCGAAAGACCAA
                      ____________________________________________________________
consensus GTGAGAAGTTCCCAAGCCCATTGAATGGCCTCTGTTTTGAAATAATCTCCGAAAGACCAA
 
. : . : . : . : . : . :
JMFS071A12+ TTACCAAGCATCTCAAAGAAGGTATGGTGATAAGTGTCCTTGCCAACATCATCAAGATCA
JMFS070A10+ TTACCAAGCATCTCAAAGAAGGTATGGTGATAAGTGTCCTTGCCAACATCATCAAGATCA
                      ____________________________________________________________
consensus TTACCAAGCATCTCAAAGAAGGTATGGTGATAAGTGTCCTTGCCAACATCATCAAGATCA
 
. : . : . : . : . : . :
JMFS071A12+ TTATGTTTCCCACCAGCTCTGATGCACTTCTGCGTATCACATGCGCGCTTCATTTTCCCC
JMFS070A10+ TTATGTTTCCCACCAGCTCTGATGCACTTCTGCGTATCACATGCGCGCTTCATTTTCCCC
                      ____________________________________________________________
consensus TTATGTTTCCCACCAGCTCTGATGCACTTCTGCGTATCACATGCGCGCTTCATTTTCCCC
 
. : . : . : . : . : . :
JMFS071A12+ AATTCAGTGTTTGGATCCACAGTTCCTAAAAAGATAGGCTTGAACTGATTCATGCCTGCA
JMFS070A10+ AATTCAGTGTTTGGATCCACAGTTCCTAAAAAGATAGGCTTGAACTGATTCATGCCTGCA
                      ____________________________________________________________
consensus AATTCAGTGTTTGGATCCACAGTTCCTAAAAAGATAGGCTTGAACTGATTCATGCCTGCA
 
. : . : . : . : . : . :
JMFS071A12+ TTGGCAAAGAGGAGGGTCGGGTCATTGTGAGGAACAACGGGGCTGGACTGGACACATTTG
JMFS070A10+ TTGGCAAAGAGGAGGGTCGGGTCATTGTGAGGAACAACGGGGCTGGACTGGACACATTTG
                      ____________________________________________________________
consensus TTGGCAAAGAGGAGGGTCGGGTCATTGTGAGGAACAACGGGGCTGGACTGGACACATTTG
 
. : . : . : . : . : . :
JMFS071A12+ TGATCCTTGCTTTCGAAGAACTGGAGGAAAGTATCCCGGACCTTTCTGGCTGGCCACTCC
JMFS070A10+ TGATCCTTGCTTTCGAAGAACTGGAGGAAAGTATCCCGGACCTTTCTGGCTGGCCACTCC
JMSF011B24+ ACTGGAGGAAAGTATCCCGGACCTTTCTGGCTGGCCACTCC
                      ____________________________________________________________
consensus TGATCCTTGCTTTCGAAGAACTGGAGGAAAGTATCCCGGACCTTTCTGGCTGGCCACTCC
 
. : . : . : . : . : . :
JMFS071A12+ AATCCCGCC
JMFS070A10+ AATCCCGCC
JMSF011B24+ AATCCCGCCGCCGTCAGCTGAGAGCTCATCGTTGGAACTGGAGTCAACGCAGACGCAGAG
                      ____________________________________________________________
consensus AATCCCGCCGCCGTCAGCTGAGAGCTCATCGTTGGAACTGGAGTCAACGCAGACGCAGAG
 
. : . : . : . : . : . :
JMSF011B24+ AAACGTCGCCGGAAAATACTACCTACTGCCGGAGCTTCCTCCTCCGCCACCGCCGCCGCC
                      ____________________________________________________________
consensus AAACGTCGCCGGAAAATACTACCTACTGCCGGAGCTTCCTCCTCCGCCACCGCCGCCGCC
 
. : . : . : . : . : . :
JMSF011B24+ GCGGCGCAGTAAGAGGAAGAAGGAGGCGGTGGTTTGCGCCAATTTACCGGGAAAAACAGA
                      ____________________________________________________________
consensus GCGGCGCAGTAAGAGGAAGAAGGAGGCGGTGGTTTGCGCCAATTTACCGGGAAAAACAGA
 
. : . : . : . : . : . :
JMSF011B24+ GCACAGCGGATGTAACTACTGCCTGCTCTCGTATAAATCCTCATTCATGATTCATCTCCA
                      ____________________________________________________________
consensus GCACAGCGGATGTAACTACTGCCTGCTCTCGTATAAATCCTCATTCATGATTCATCTCCA