Previous Contig 005200:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS089F01Sequence649005200 (6)pir|B84631|B846314e-81hypothetical protein At2g23980 [imported] - Arabidopsis thaliana
JMFS089F08Sequence591005200 (6)pir|B84631|B846311e-73hypothetical protein At2g23980 [imported] - Arabidopsis thaliana
JMFS112G10Sequence621005200 (6)pir|B84631|B846311e-76hypothetical protein At2g23980 [imported] - Arabidopsis thaliana
JMSF011A12Sequence216005200 (6)727003527 (4)pir|B84631|B846318e-89hypothetical protein At2g23980 [imported] - Arabidopsis thaliana
JMSF014P23Sequence234005200 (6)sp|Q9S9N5|CNG7_ARATH0.014Putative cyclic nucleotide-gated ion channel 7 (Cyclic nucleotide- and calmoduli720003527 (4)pir|T52573|T525732e-74cyclic nucleotide and calmodulin-regulated ion channel [imported] - Arabidopsis
JMSF022L12Sequence697005200 (6)sp|O82226|CNG6_ARATH2e-61Probable cyclic nucleotide-gated ion channel 6 (AtCNGC6) (Cyclic nucleotide- and781003527 (4)pir|B84631|B84631e-100hypothetical protein At2g23980 [imported] - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS089F01+ GATAAAAAGCAATGCCTGTTTTGTAGCTAGTACATCTGACCC
JMFS112G10+ GTACATCTGACCC
                      ____________________________________________________________
consensus GATAAAAAGCAATGCCTGTTTTGTAGCTAGTACATCTGACCC
 
. : . : . : . : . : . :
JMFS089F01+ TTTTGATCTCTGTAGAAATCTCCAGACTACAATCTGAGGCAAAGGTAGCACCGCAAGAAA
JMFS112G10+ TTNTGATCTCTGTAGAAATCTCCAGACTACAATCTGAGGCAAAGGTAGCACCGCAAGAAA
JMFS089F08+ CCAGACTACAATCTGAGGCAAAGGTAGCACCGCAAGANA
                      ____________________________________________________________
consensus TTTTGATCTCTGTAGAAATCTCCAGACTACAATCTGAGGCAAAGGTAGCACCGCAAGAAA
 
. : . : . : . : . : . :
JMFS089F01+ ATCAATGATAAAATAGGTGCGCAGGTATCGTTTAGCAATTTGTCCAGGATCTATTACAAG
JMFS112G10+ ATCAATGATAAAATAGGTGCGCAGGTATCGTTTAGCAATTTGTCCAGGATCTATTACAAG
JMFS089F08+ ATCAATGATAAAATAGGTGCGCAGGTATCGTTTAGCAATTTGTCCAGGATCTATTACAAG
                      ____________________________________________________________
consensus ATCAATGATAAAATAGGTGCGCAGGTATCGTTTAGCAATTTGTCCAGGATCTATTACAAG
 
. : . : . : . : . : . :
JMFS089F01+ CTCACCCCGACCAAAAACCCGAGATGATGGAGCAATATAAGCTGTGCGAAATTGAAGGGC
JMFS112G10+ CTCACCCCGACCAAAAACCCGAGATGATGGAGCAATATAAGCTGTGCGAAATTGAAGGGC
JMFS089F08+ CTCACCCCGACCAAAAACCCGAGATGATGGAGCAATATAAGCTGTGCGAAATTGAAGGGC
JMSF022L12+ CCCGAGATGATGGAGCAATATAAGCTGTGCGAAATTGAAGGGC
                      ____________________________________________________________
consensus CTCACCCCGACCAAAAACCCGAGATGATGGAGCAATATAAGCTGTGCGAAATTGAAGGGC
 
. : . : . : . : . : . :
JMFS089F01+ CATATGAAAGAGATAGAAAGCATCGATAACCGTTCGCAACGTTGTCGCTATTATAGCCAA
JMFS112G10+ CATATGAAAGAGATAGAAAGCATCGATAACCGTTCGCAACGTTGTCGCTATTATAGCCAA
JMFS089F08+ CATATGAAAGAGATAGAAAGCATCGATAACCGTTCGCAACGTTGTCGCTATTATAGCCAA
JMSF022L12+ CATATGAAAGAGATAGAAAGCATCGATAACCGTTCGCAACGTTGTCGCTATTATAGCCAA
                      ____________________________________________________________
consensus CATATGAAAGAGATAGAAAGCATCGATAACCGTTCGCAACGTTGTCGCTATTATAGCCAA
 
. : . : . : . : . : . :
JMFS089F01+ CTTTCGATCAATCCCAAGACAATTTGACTGATCATTAAAAACTGGAAGGTAGAAAAACAG
JMFS112G10+ CTTTCGATCAATCCCAAGACAATTTGACTGATCATTAAAAACTGGAAGGTAGAAAAACAG
JMFS089F08+ CTTTCGATCAATCCCAAGACAATTTGACTGATCATTAAAAACTGGAAGGTAGAAAAACAG
JMSF022L12+ CTTTCGATCAATCCCAAGACAATTTGACTGATCATTAAAAACTGGAAGGTAGAAAAACAG
                      ____________________________________________________________
consensus CTTTCGATCAATCCCAAGACAATTTGACTGATCATTAAAAACTGGAAGGTAGAAAAACAG
 
. : . : . : . : . : . :
JMFS089F01+ AGGATCCACAGAGACGCCCAGGATACATGATATGACAAATAGCCTATTCCACAAAACAAG
JMFS112G10+ AGGATCCACAGAGACGCCCAGGATACATGATATGACAAATAGCCTATTCCACAAAACAAG
JMFS089F08+ AGGATCCACAGAGACGCCCAGGATACATGATATGACAAATAGCCTATTCCACAAAACAAG
JMSF022L12+ AGGATCCACAGAGACGCCCAGGATACATGATATGACAAATAGCCTATTCCACAAAACAAG
                      ____________________________________________________________
consensus AGGATCCACAGAGACGCCCAGGATACATGATATGACAAATAGCCTATTCCACAAAACAAG
 
. : . : . : . : . : . :
JMFS089F01+ GAATTTATCCTGAGGGTCAAATATCTTCTTGTCTGAAGCTTTAAGATCTTCAGGAAAAAC
JMFS112G10+ GAATTTATCCTGAGGGTCAAATATCTTCTTGTCTGAAGCTTTAAGATCTTCAGGAAAAAC
JMFS089F08+ GAATTTATCCTGAGGGTCAAATATCTTCTTGTCTGAAGCTTTAAGATCTTCAGGAAAAAC
JMSF022L12+ GAATTTATCCTGAGGGTCAAATATCTTCTTGTCTGAAGCTTTAAGATCTTCAGGAAAAAC
                      ____________________________________________________________
consensus GAATTTATCCTGAGGGTCAAATATCTTCTTGTCTGAAGCTTTAAGATCTTCAGGAAAAAC
 
. : . : . : . : . : . :
JMFS089F01+ AGCTCGAGACACACCAAAGCCCAGAGATCGACCAATTGACTTAAGACCTTCAGAACCTTT
JMFS112G10+ AGCTCGAGACACACCAAAGCCCAGAGATCGACCAATTGACTTAAGACCTTCAGAACCTTT
JMFS089F08+ AGCTCGAGACACACCAAAGCCCAGAGATCGACCAATTGACTTAAGACCTTCAGAACCTTT
JMSF022L12+ AGCTCGAGACACACCAAAGCCCAGAGATCGACCAATTGACTTAAGACCTTCAGAACCTTT
                      ____________________________________________________________
consensus AGCTCGAGACACACCAAAGCCCAGAGATCGACCAATTGACTTAAGACCTTCAGAACCTTT
 
. : . : . : . : . : . :
JMFS089F01+ TCTCATTCCTTTCTTGAAAGAACTTGATGTACCTGTAGTTGTAGGACCAGCACGTTTTAA
JMFS112G10+ TCTCATTCCTTTCTTGAAAGAACTTGATGTACCTGTAGTTGTAGGACCAGCACGTTTTAA
JMFS089F08+ TCTCATTCCTTTCTTGAAAGAACTTGATGTACCTGTAGTTGTAGGACCAGCACGTTTTAA
JMSF022L12+ TCTCATTCCTTTCTTGAAAGAACTTGATGTACCTGTAGTTGTAGGACCAGCACGTTTTAA
                      ____________________________________________________________
consensus TCTCATTCCTTTCTTGAAAGAACTTGATGTACCTGTAGTTGTAGGACCAGCACGTTTTAA
 
. : . : . : . : . : . :
JMFS089F01+ ACCCTCAACACCAAAGCTACATTTGTTTGCTGCTACTGATGCTGCCGGTGAGGAAAGCCT
JMFS112G10+ ACCCTCAACACCAAAGCTACATTTGTTTGCTGCTACTGATGCTGCCGGTGAGGAAAGCCT
JMFS089F08+ ACCCTCAACACCAAAGCTACATTTGTTTGCTGCTACTGATGCTGCCGGTGAGGAAAGCCT
JMSF022L12+ ACCCTCAACACCAAAGCTACATTTGTTTGCTGCTACTGATGCTGCCGGTGAGGAAAGCCT
                      ____________________________________________________________
consensus ACCCTCAACACCAAAGCTACATTTGTTTGCTGCTACTGATGCTGCCGGTGAGGAAAGCCT
 
. : . : . : . : . : . :
JMFS089F01+ GGAATCC
JMFS112G10+ GGAATCC
JMFS089F08+ GGAATCC
JMSF022L12+ GGAATCCAAGTCATCCAGCCTTACAAACTTTTCTCGCTGTCCACCCAGATACTGAGACTT
JMSF014P23+ GGAATCCAAGTCATCCAGCCTTACAAACTTTTCTCGCTGTCCACCCAGATACTGAGACTT
                      ____________________________________________________________
consensus GGAATCCAAGTCATCCAGCCTTACAAACTTTTCTCGCTGTCCACCCAGATACTGAGACTT
 
. : . : . : . : . : . :
JMSF022L12+ AGCACCACAATCGAACATATTGTACAATCATAAAACACATAAACCTAAAATTACAATAAG
JMSF014P23+ AGCACCACAATCGAACATATTGTACAATCATAAAACACATAAACCTAAAATTACAATAAG
JMSF011A12+ CAATCATAAAACACATAAACCTAAAATTACAATAAG
                      ____________________________________________________________
consensus AGCACCACAATCGAACATATTGTACAATCATAAAACACATAAACCTAAAATTACAATAAG
 
. : . : . : . : . : . :
JMSF022L12+ AGGTAATGAGATGAGTCCATGGTGGGGAAGCGAGGTCGCCGGCGAGTTGGTTGTGAGGTC
JMSF014P23+ AGGTAATGAGATGAGTCCATGGTGGGGAAGCGAGGTCGCCGGCGAGTTGGTTGTGAGGTC
JMSF011A12+ AGGTAATGAGATGAGTCCATGGTGGGGAAGCGAGGTCGCCGGCGAGTTGGTTGTGAGGTC
                      ____________________________________________________________
consensus AGGTAATGAGATGAGTCCATGGTGGGGAAGCGAGGTCGCCGGCGAGTTGGTTGTGAGGTC
 
. : . : . : . : . : . :
JMSF022L12+ CGGCGGGGCGACGTGAGCGACGGATATGAAGTCAAAGTTTATCTGGAAGA
JMSF014P23+ CGGCGGGGCGACGTGAGCGACGGATATGAAGTCAAAGTTTATCTGGAAGA
JMSF011A12+ CGGCGGGGCGACGTGAGCGACGGATATGAAGTCAAAGTTTATCTGGAAGAGCTAATAGTT
                      ____________________________________________________________
consensus CGGCGGGGCGACGTGAGCGACGGATATGAAGTCAAAGTTTATCTGGAAGAGCTAATAGTT
 
. : . : . : . : . : . :
JMSF011A12+ TGGGTAGACAGGTTGGACCAAAGTGGGAAGAAACGAAGTGCGAAAGTAGGGTCAACTATC
                      ____________________________________________________________
consensus TGGGTAGACAGGTTGGACCAAAGTGGGAAGAAACGAAGTGCGAAAGTAGGGTCAACTATC