Previous Contig 005198:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005M09Sequence507005198 (5)gb:AF123390_17698891e-62Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl729010249 (9)sp|O64982|PRS7_PRUPE4e-9426S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMFF011A13Sequence513005198 (5)gb:AF123390_17698891e-93Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl729010249 (9)sp|O64982|PRS7_PRUPE4e-8426S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMFF042L18Sequence645005198 (5)gb:AF123390_17698894e-88Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl612010249 (9)sp|O64982|PRS7_PRUPE5e-5526S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMSF009B23Sequence268005198 (5)gb:AF123390_17698894e-44Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl770010249 (9)sp|O64982|PRS7_PRUPEe-10426S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA
JMSF011A09Sequence202005198 (5)gb:AF123390_17698891e-12Arabidopsis thaliana 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, compl779010249 (9)sp|O64982|PRS7_PRUPEe-10626S protease regulatory subunit 7 (26S proteasome subunit 7) (26S proteasome AAA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011A13+ TATTAGCCACTGCCCTAGCCAGTAGTGTTTTCCCTGT
                      ____________________________________________________________
consensus TATTAGCCACTGCCCTAGCCAGTAGTGTTTTCCCTGT
 
. : . : . : . : . : . :
JMFF011A13+ TCCAGGAGGACCATAGCAAAGAACACCNTTAGGTGGGTCAATTCCGAGCTTCACAAACTT
                      ____________________________________________________________
consensus TCCAGGAGGACCATAGCAAAGAACACCNTTAGGTGGGTCAATTCCGAGCTTCACAAACTT
 
. : . : . : . : . : . :
JMFF011A13+ TTCTGGGTGGAGCATTGGCAGTTCAACCACCTCTCGCATCTTTTCAATTTGTTCCTTGCA
JMFF042L18+ TTGGCAGTTCAACCACCTCTCGCATCTNTTCAATTTGTTCCTTGCA
                      ____________________________________________________________
consensus TTCTGGGTGGAGCATTGGCAGTTCAACCACCTCTCGCATCTTTTCAATTTGTTCCTTGCA
 
. : . : . : . : . : . :
JMFF011A13+ TCCACCAACATCATTGTAGGTCACATCAGGCTTTTCCTCAACTGTCATCATGGTGACACT
JMFF042L18+ TCCACCAACATCATNGTAGGTCACATCAGGCTTTTCCTCAACTGTCATCATGGTGACACT
                      ____________________________________________________________
consensus TCCACCAACATCATTGTAGGTCACATCAGGCTTTTCCTCAACTGTCATCATGGTGACACT
 
. : . : . : . : . : . :
JMFF011A13+ TGGATCAATTTTGGGAGGCAAAGGAATCTGGATTTGATATTTATTCCGATCAACTCCAAC
JMFF042L18+ TGGATCAATTTTGGGAGGCAAAGGAATCTGGATNTGATATTTATTCCGATCAACTCCAAC
JMSF009B23+ TCCGATCAACTCCAAC
JMFF005M09+ TGATATTTATTCCGATCAACTCCAAC
                      ____________________________________________________________
consensus TGGATCAATTTTGGGAGGCAAAGGAATCTGGATTTGATATTTATTCCGATCAACTCCAAC
 
. : . : . : . : . : . :
JMFF011A13+ TCGCATGCCCTCTTCAATATCAGTTGGTGAAACTTTGTCACCCAATCCAACAACAAACTT
JMFF042L18+ TCGCATGCCCTCTTCAATATCAGTTGGTGAAACTTTGTCACCCAATCCAACAACAAACTT
JMSF009B23+ TCGCATGCCCTCTTCAATATCAGTTGGTGAAACTTTGTCACCCAATCCAACAACAAACTT
JMFF005M09+ TCGCATGCCCTCTTCAATATCAGTTGGTGAAACTTTGTCACCCAATCCAACAACAAACTT
                      ____________________________________________________________
consensus TCGCATGCCCTCTTCAATATCAGTTGGTGAAACTTTGTCACCCAATCCAACAACAAACTT
 
. : . : . : . : . : . :
JMFF011A13+ TGCTATTTGCTTCACATTTATCACATATTTTGCATCTTCAGTATTAGGACTGATTATTTT
JMFF042L18+ TGCTATTTGCTTCACATTTATCACATATTTTGCATCTTCAGTATTAGGACTGATTATTTT
JMSF009B23+ TGCTATTTGCTTCACATTTATCACATATTTTGCATCTTCAGTATTAGGACTGATTATTTT
JMFF005M09+ TGCTATTTGCTTCACATTTATCACATATTTTGCATCTTCAGTATTAGGACTGATTATTTT
                      ____________________________________________________________
consensus TGCTATTTGCTTCACATTTATCACATATTTTGCATCTTCAGTATTAGGACTGATTATTTT
 
. : . : . : . : . : . :
JMFF011A13+ TGTACATCTTGCCACCTGAAGGGGTTGCTCCTCCTGCATCATTTGCTTATCAGAAACCAA
JMFF042L18+ TGTACATCTTGCCACCTGAAGGGGTTGCTCCTCCTGCATCATTTGCTTATCAGAAACCAA
JMSF009B23+ TGTACATCTTGCCACCTGAAGGGGTTGCTCCTCCTGCATCATTTGCTTATCAGAAACCAA
JMFF005M09+ TGTACATCTTGCCACCTGAAGGGGTTGCTCCTCCTGCATCATTTGCTTATCAGAAACCAA
                      ____________________________________________________________
consensus TGTACATCTTGCCACCTGAAGGGGTTGCTCCTCCTGCATCATTTGCTTATCAGAAACCAA
 
. : . : . : . : . : . :
JMFF011A13+ ATCCCATTGGCTTGGTGCAGCTAAGCCAGTGTCAGATTCCTTAATACCACATAAAT
JMFF042L18+ ATCCCATTGGCTTGGTGCAGCTAAGCCAGTGTCAGATTCCTTAATACCACATAAATCATT
JMSF009B23+ ATCCCATTGGCTTGGTGCAGCTAAGCCAGTGTCAGATTCCTTAATACCACATAAATCATT
JMFF005M09+ ATCCCATTGGCTTGGTGCAGCTAAGCCAGTGTCAGATTCCTTAATACCACATAAATCATT
                      ____________________________________________________________
consensus ATCCCATTGGCTTGGTGCAGCTAAGCCAGTGTCAGATTCCTTAATACCACATAAATCATT
 
. : . : . : . : . : . :
JMFF042L18+ AATCTTTTTAGCCATTTCCTTGATTTCCTTTTCAGCTTTCTTTATGCTTGTTGAATAAGG
JMSF009B23+ AATCTTTTTAGC
JMFF005M09+ AATCTTTTTAGCCATTTCCTTGATTTCCTTTTCAGCTTTCTTTATGCTTGTTGAATAAGG
JMSF011A09+ TCTTTATGCTTGTTGAATAAGG
                      ____________________________________________________________
consensus AATCTTTTTAGCCATTTCCTTGATTTCCTTTTCAGCTTTCTTTATGCTTGTTGAATAAGG
 
. : . : . : . : . : . :
JMFF042L18+ TCCCAGACCATATGTCTTAAGGAGAGCAATATCGTCCTCATCGAGCGGCCTAGGGTTCTT
JMFF005M09+ TCCCAGACCATATGTCTTAAGGAGAGCAATATCGTCCTCATCGAGCGGCCTAGGGTTCTT
JMSF011A09+ TCCCAGACCATATGTCTTAAGGAGAGCAATATCGTCCTCATCGAGCGGCCTAGGGTTCTT
                      ____________________________________________________________
consensus TCCCAGACCATATGTCTTAAGGAGAGCAATATCGTCCTCATCGAGCGGCCTAGGGTTCTT
 
. : . : . : . : . : . :
JMFF042L18+ CTCGTCCTTGATCTCATCCTCCACATCCCGGGCGGGTGCCATGCTTCCGAGATTCCTTTC
JMFF005M09+ CTCGTCCTTGATCTCATCCTCCACATCCCGGGCGGGTGCCATGCTTCCGAGATTCCTTTC
JMSF011A09+ CTCGTCCTTGATCTCATCCTCCACATCCCGGGCGGGTGCCATGCTTCCGAGATTCCTTTC
                      ____________________________________________________________
consensus CTCGTCCTTGATCTCATCCTCCACATCCCGGGCGGGTGCCATGCTTCCGAGATTCCTTTC
 
. : . : . : . : . : . :
JMFF042L18+ TTCTTCTTCTCTTCTTCCTCCTAACAATCGCAGAGTTGAGAAAGTTTGGAGAACAA
JMFF005M09+ TTCTTCTTCTCTTCTTCCTCCTAACAATCGCAGAGTTGAGAAAGTTTGGAGAACAA
JMSF011A09+ TTCTTCTTCTCTTCTTCCTCCTAACAATCGCAGAGTTGAGAAAGTTTGGAGAACAAGCCC
                      ____________________________________________________________
consensus TTCTTCTTCTCTTCTTCCTCCTAACAATCGCAGAGTTGAGAAAGTTTGGAGAACAAGCCC