Previous Contig 005194:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS051H04Sequence579005194 (3)gb:OSJN00096_16948409e-32Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0012E24, complete seque
JMFS150G10Sequence613005194 (3)gb:OSJN00096_16948401e-32Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0012E24, complete seque
JMSF010P18Sequence257005194 (3)gb:AY542310_11883101e-07Zea mays chromosome 2 clone Z556K20 map 2S, *** SEQUENCING IN PROGRESS ***, 8 or746022406sp|Q9SH30|AHM7_ARATH2e-79Potential copper-transporting ATPase 3 (EC 3.6.3.4).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS051H04+ AAGGACCGACGATATTGACTGATTTCCTGCTGCCTGTGACCTTCTTTATCTCCTTCAGGA
JMFS150G10+ AAGGACCGACGATATTGACTGATTTCCTGCTGCCTGTGACCTTCTTTATCTCCTTCAGGA
                      ____________________________________________________________
consensus AAGGACCGACGATATTGACTGATTTCCTGCTGCCTGTGACCTTCTTTATCTCCTTCAGGA
 
. : . : . : . : . : . :
JMFS051H04+ TATACCTTCGCCTTGAATTGGAAGCTCCCTGCAGAGCCAATCGACTCGATTACTTGAATA
JMFS150G10+ TATACCTTTGCCTTGAATTGGAAGCTCCCTGCAGAGCCAATCGACTCGATTACTTGAATA
                      ____________________________________________________________
consensus TATACCTTTGCCTTGAATTGGAAGCTCCCTGCAGAGCCAATCGACTCGATTACTTGAATA
 
. : . : . : . : . : . :
JMFS051H04+ AAAACTCTGGGTCCTGTTACAGCTGATTCGTAAGAAATAGAGACCTTATTGAGCTGAGGA
JMFS150G10+ AAAACTCTGGGTCCTGTTACAGCTGATTCGTAAGAAATAGAGACCTTATTGAGCTGAGGA
                      ____________________________________________________________
consensus AAAACTCTGGGTCCTGTTACAGCTGATTCGTAAGAAATAGAGACCTTATTGAGCTGAGGA
 
. : . : . : . : . : . :
JMFS051H04+ TCAATGTCAATATCCTCAACACCCGGGAGCGCTTCAAGAGAATTCGCAATCAAAATCATG
JMFS150G10+ TCAATGTCAATATCCTCAACACCCGGGAGCGCTTCAAGAGAATTCGCAATCAAAATCATG
                      ____________________________________________________________
consensus TCAATGTCAATATCCTCAACACCCGGGAGCGCTTCAAGAGAATTCGCAATCAAAATCATG
 
. : . : . : . : . : . :
JMFS051H04+ GAATTTTCACTTTCCATTCCATCAACTTTCAGTGCTATCTTGCTGCTTCAATNTTCGCCT
JMFS150G10+ GAATTTTCACCTTCCACTCCATCAACTTTCAGTGCTATCTTGCTGCTTCTATCTTCGCCT
                      ____________________________________________________________
consensus GAATTTTCACTTTCCATTCCATCAACTTTCAGTGCTATCTTGCTGCTTCTATCTTCGCCT
 
. : . : . : . : . : . :
JMFS051H04+ GTACTAATCAGCATTGCCTCGAATCCCATCTCTTCTATGGCTTGCAGGATTGTTTCCTCA
JMFS150G10+ GTACTAATCAGCATTGCCTCGAATCCCATCTCTTCTATGGCTTGCAGGATTGTTTCCTCA
                      ____________________________________________________________
consensus GTACTAATCAGCATTGCCTCGAATCCCATCTCTTCTATGGCTTGCAGGATTGTTTCCTCA
 
. : . : . : . : . : . :
JMFS051H04+ TTGACAGAAGTTGGATAAAACAAGACTAGAGCCCTGTTATTCAAGACGTCAACCGCCGCA
JMFS150G10+ TTGACAGAAGTTGGATAAAACAAGACTAGAGCCCTGTTATTCAAGACGTCAACCGCCGCA
JMSF010P18+ AGACGTCAACCGCCGCA
                      ____________________________________________________________
consensus TTGACAGAAGTTGGATAAAACAAGACTAGAGCCCTGTTATTCAAGACGTCAACCGCCGCA
 
. : . : . : . : . : . :
JMFS051H04+ TATTTAATTCCGGGGAGTCTCTTGACGGCCTTCTCCACCGTGACGGCGCATGCAGAGCAA
JMFS150G10+ TATTTAATTCCGGGGAGTCTCTTGACGGCCTTCTCCACCGTGACGGCGCATGCAGAGCAA
JMSF010P18+ TATTTAATTCCGGGGAGTCTCTTGACGGCCTTCTCCACCGTGACGGCGCATGCAGAGCAA
                      ____________________________________________________________
consensus TATTTAATTCCGGGGAGTCTCTTGACGGCCTTCTCCACCGTGACGGCGCATGCAGAGCAA
 
. : . : . : . : . : . :
JMFS051H04+ GTCATTCCGGCAACCGAAAACACCGCCTTCGCCGCCTCCCTTCCCTGCACCATTCTTTTC
JMFS150G10+ GTCATTCCGGCAACCGAAAACACCGCCTTCGCCGCCTCCCTTCCCTGCACCATTCTTTTC
JMSF010P18+ GTCATTCCGGCAACCGAAAACACCGCCTTCGCCGCCTCCCTTCCCTGCACCATTCTTTTC
                      ____________________________________________________________
consensus GTCATTCCGGCAACCGAAAACACCGCCTTCGCCGCCTCCCTTCCCTGCACCATTCTTTTC
 
. : . : . : . : . : . :
JMFS051H04+ TCTTCACCTTTCGGAAACTTAGCNTCTTCTTCCTCTT
JMFS150G10+ TCTTCACCTTTCGGAAACTTAGCTTCTTCTTCCTCTTCTGCGGAGAAGTTGCCTTAGCTT
JMSF010P18+ TCTTCACCTTTCGGAAACTTAGCTTCTTCTTCCTCTTCTGCGGAGAAGTTGCCTTAGCTT
                      ____________________________________________________________
consensus TCTTCACCTTTCGGAAACTTAGCTTCTTCTTCCTCTTCTGCGGAGAAGTTGCCTTAGCTT
 
. : . : . : . : . : . :
JMFS150G10+ TTTTATTGAGCTT
JMSF010P18+ TTTTATTGAGCTTTTCATTTCTTTAATGGATATATAAAAGATAACAAGTACAGCACTACC
                      ____________________________________________________________
consensus TTTTATTGAGCTTTTCATTTCTTTAATGGATATATAAAAGATAACAAGTACAGCACTACC