Previous Contig 005180:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS120E04Sequence622005180 (2)gb:AY099727_15767526e-27Arabidopsis thaliana gamma-tubulin interacting protein-like (At5g06680) mRNA, co
JMSF010M08Sequence247005180 (2)681004179 (4)gb:AY099727_15767527e-31Arabidopsis thaliana gamma-tubulin interacting protein-like (At5g06680) mRNA, co

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS120E04+ CCATCAACAGAAAACTTCTCTACTTTTCCTACATNTGTTGAATATCCCAAATT
                      ____________________________________________________________
consensus CCATCAACAGAAAACTTCTCTACTTTTCCTACATNTGTTGAATATCCCAAATT
 
. : . : . : . : . : . :
JMFS120E04+ TCCATCCAAAGCCCTCAAAGTTTCAGAATTATCCAATGTACCAAGAGACTTTGAAGCACC
                      ____________________________________________________________
consensus TCCATCCAAAGCCCTCAAAGTTTCAGAATTATCCAATGTACCAAGAGACTTTGAAGCACC
 
. : . : . : . : . : . :
JMFS120E04+ ATTTCCAACTCGAGAATAACCGTTTGATTGCCCATCAAACAACACGGGTAATCCCCCATT
                      ____________________________________________________________
consensus ATTTCCAACTCGAGAATAACCGTTTGATTGCCCATCAAACAACACGGGTAATCCCCCATT
 
. : . : . : . : . : . :
JMFS120E04+ CACAGCGGAGCTGAAAACCCCAACTGACACCCCAGAGAGGGGCTGGCTTTTTCGGGCCTT
                      ____________________________________________________________
consensus CACAGCGGAGCTGAAAACCCCAACTGACACCCCAGAGAGGGGCTGGCTTTTTCGGGCCTT
 
. : . : . : . : . : . :
JMFS120E04+ ACGATCTTCGGAGATGGTTTTGATCAAATAAAGCAGGGCCCACTTGTTCTTAACACTTCC
                      ____________________________________________________________
consensus ACGATCTTCGGAGATGGTTTTGATCAAATAAAGCAGGGCCCACTTGTTCTTAACACTTCC
 
. : . : . : . : . : . :
JMFS120E04+ AGGGCCGGTTTTGGACGAAAATTTGGAATATAAATCAGCGAAAGTGAGGGCTTCGGATGA
                      ____________________________________________________________
consensus AGGGCCGGTTTTGGACGAAAATTTGGAATATAAATCAGCGAAAGTGAGGGCTTCGGATGA
 
. : . : . : . : . : . :
JMFS120E04+ CTTACCCTGAGTGGCCAACTGTCGCTTGATGGACTCAGCCATGGAGGCCTCGTCGACGGC
JMSF010M08+ CGACGGC
                      ____________________________________________________________
consensus CTTACCCTGAGTGGCCAACTGTCGCTTGATGGACTCAGCCATGGAGGCCTCGTCGACGGC
 
. : . : . : . : . : . :
JMFS120E04+ GATGGTAGGAGTCATGCGACTCGAGAGGATGCGAACCGCATACTTGAATGCTTGCTGGTA
JMSF010M08+ GATGGTAGGAGTCATGCGACTCGAGAGGATGCGAACCGCATACTTGAATGCTTGCTGGTA
                      ____________________________________________________________
consensus GATGGTAGGAGTCATGCGACTCGAGAGGATGCGAACCGCATACTTGAATGCTTGCTGGTA
 
. : . : . : . : . : . :
JMFS120E04+ CTGTTGCTCCGAGGGGCTAGGGTTAGGGTTAGAGTCGGAGGAGGTGGAAGACTGCGGGGA
JMSF010M08+ CTGTTGCTCCGAGGGGCTAGGGTTAGGGTTAGAGTCGGAGGAGGTGGAAGACTGCGGGGA
                      ____________________________________________________________
consensus CTGTTGCTCCGAGGGGCTAGGGTTAGGGTTAGAGTCGGAGGAGGTGGAAGACTGCGGGGA
 
. : . : . : . : . : . :
JMFS120E04+ GGTGTACAGTAAACGGTGGACTAGCTCTTTGACTAGATCTAAAACCCGCTGGTCGTCATC
JMSF010M08+ GGTGTACAGTAAACGGTGGACTAGCTCTTTGACTAGATCTAAAACCCGCTGGTCGTCATC
                      ____________________________________________________________
consensus GGTGTACAGTAAACGGTGGACTAGCTCTTTGACTAGATCTAAAACCCGCTGGTCGTCATC
 
. : . : . : . : . : . :
JMFS120E04+ TGCCATGGTTGCCGGAGGACGGTACCTGC
JMSF010M08+ TGCCATGGTTGCCGGAGGACGGTACCTGCCGGCGGGTGGGTAGTGGGTGGGGGACTGTCC
                      ____________________________________________________________
consensus TGCCATGGTTGCCGGAGGACGGTACCTGCCGGCGGGTGGGTAGTGGGTGGGGGACTGTCC