Previous Contig 005168:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010I14Sequence472005168 (2)gb:AK119039_18169845e-32Arabidopsis thaliana At2g28100 mRNA for unknown protein, complete cds, clone: RA774011577 (2)gb:AK119039_18169841e-32Arabidopsis thaliana At2g28100 mRNA for unknown protein, complete cds, clone: RA
JMSF047C16Sequence715005168 (2)gb:AK119039_18169846e-96Arabidopsis thaliana At2g28100 mRNA for unknown protein, complete cds, clone: RA758011577 (2)gb:AK119039_18169849e-32Arabidopsis thaliana At2g28100 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047C16+ CACGACCAAAAGGGTCTCCCATTC
                      ____________________________________________________________
consensus CACGACCAAAAGGGTCTCCCATTC
 
. : . : . : . : . : . :
JMSF047C16+ CTATATATTCGTAATCATTGCCACCAATAGTTACATCGCTACGATTTAAAAGGGACCAAC
                      ____________________________________________________________
consensus CTATATATTCGTAATCATTGCCACCAATAGTTACATCGCTACGATTTAAAAGGGACCAAC
 
. : . : . : . : . : . :
JMSF047C16+ AAGTCGTCCCGGCAATACCATCTTCATCTCCTATCCATCTGGTATCGGGGCCAGCATCTG
                      ____________________________________________________________
consensus AAGTCGTCCCGGCAATACCATCTTCATCTCCTATCCATCTGGTATCGGGGCCAGCATCTG
 
. : . : . : . : . : . :
JMSF047C16+ TGAAGATTGTGGCCCCAGGTTGGAGCTGATGGATAAGGTCGAACCAATCATCAAAATAAT
                      ____________________________________________________________
consensus TGAAGATTGTGGCCCCAGGTTGGAGCTGATGGATAAGGTCGAACCAATCATCAAAATAAT
 
. : . : . : . : . : . :
JMSF047C16+ ACTCCATATCCTTCTCGCCCTCACCTTTTGCACCATCCAGGAACACTTCTTTAATCTCAC
                      ____________________________________________________________
consensus ACTCCATATCCTTCTCGCCCTCACCTTTTGCACCATCCAGGAACACTTCTTTAATCTCAC
 
. : . : . : . : . : . :
JMSF047C16+ CATATCTTGTAAGCAACTCAGTCATCTGCCCCAAATAGAATTCATTGTACTCAACAGTGT
                      ____________________________________________________________
consensus CATATCTTGTAAGCAACTCAGTCATCTGCCCCAAATAGAATTCATTGTACTCAACAGTGT
 
. : . : . : . : . : . :
JMSF047C16+ TGCCATATACAGACTCATGTCTATCCCAAGGTGAAAGATAAAGACCCAATTGCAGACCAG
                      ____________________________________________________________
consensus TGCCATATACAGACTCATGTCTATCCCAAGGTGAAAGATAAAGACCCAATTGCAGACCAG
 
. : . : . : . : . : . :
JMSF047C16+ CAGCCTTGGCAGCCTGAGCCAAATCGCCCACTATATCACCGGACCCATTTCTCCAAGGGC
                      ____________________________________________________________
consensus CAGCCTTGGCAGCCTGAGCCAAATCGCCCACTATATCACCGGACCCATTTCTCCAAGGGC
 
. : . : . : . : . : . :
JMSF047C16+ AAGACTTGACGGAGTAATTAGTGTAGAGAGAAGGCCAGAGACAGAACCCATCATGGTGCT
JMSF010I14+ ACGGAGTAATTAGTGTAGAGAGAAGGCCAGAGACAGAACCCATCATGGTGCT
                      ____________________________________________________________
consensus AAGACTTGACGGAGTAATTAGTGTAGAGAGAAGGCCAGAGACAGAACCCATCATGGTGCT
 
. : . : . : . : . : . :
JMSF047C16+ TAGCAGTGAGGACCAATCTTGTGAACCCATTTTCCTTCGCAACGGAGACCCACTGGGTGG
JMSF010I14+ TAGCAGTGAGGACCAATCTTGTGAACCCATTTTCCTTCGCAACGGAGACCCACTGGGTGG
                      ____________________________________________________________
consensus TAGCAGTGAGGACCAATCTTGTGAACCCATTTTCCTTCGCAACGGAGACCCACTGGGTGG
 
. : . : . : . : . : . :
JMSF047C16+ CATTGAGGCTAGCCGGGTTGAAGATCGACGGGTCAACGTGACCCGACCCCCACTCCGAAC
JMSF010I14+ CATTGAGGCTAGCCGGGTTGAAGATCGACGGGTCAACGTGACCCGACCCCCACTCCGAAC
                      ____________________________________________________________
consensus CATTGAGGCTAGCCGGGTTGAAGATCGACGGGTCAACGTGACCCGACCCCCACTCCGAAC
 
. : . : . : . : . : . :
JMSF047C16+ CCACGAAAGTGTTGGGCCCAAAGTGGAGAAACATGGCCATCTCCGAGAGCTGCCATAAAA
JMSF010I14+ CCACGAAAGTGTTGGGCCCAAAGTGGAGAAACATGGCCATCTCCGAGAGCTGCCATAAAA
                      ____________________________________________________________
consensus CCACGAAAGTGTTGGGCCCAAAGTGGAGAAACATGGCCATCTCCGAGAGCTGCCATAAAA
 
. : . : . : . : . : . :
JMSF047C16+ GCTGCCGTGCCGAAGGGATTGGCAGAAGAG
JMSF010I14+ GCTGCCGTGCCGAAGGGATTGGCAGAAGAGGAATTGGAGGCGGCGTTGGGTGTGCGCCAA
                      ____________________________________________________________
consensus GCTGCCGTGCCGAAGGGATTGGCAGAAGAGGAATTGGAGGCGGCGTTGGGTGTGCGCCAA
 
. : . : . : . : . : . :
JMSF010I14+ AGGAACGGGTAGACTGAGAGAGTAGGTAGAGTAGGTGGATAAGAACTACAAGACTGTTTC
                      ____________________________________________________________
consensus AGGAACGGGTAGACTGAGAGAGTAGGTAGAGTAGGTGGATAAGAACTACAAGACTGTTTC
 
. : . : . : . : . : . :
JMSF010I14+ TTTCGATGGTCCGATGATGTTTTGCCACCACAGTGTCCACGATCATCTTCCCCAACACTA
                      ____________________________________________________________
consensus TTTCGATGGTCCGATGATGTTTTGCCACCACAGTGTCCACGATCATCTTCCCCAACACTA
 
. : . : . : . : . : . :
JMSF010I14+ CTTTACACCTCCAGGAATACTGCTTCTGATCTTCTTGGAATTCACTCATTGTTGCTTGCC
                      ____________________________________________________________
consensus CTTTACACCTCCAGGAATACTGCTTCTGATCTTCTTGGAATTCACTCATTGTTGCTTGCC