Previous Contig 005165:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010I01Sequence366005165 (2)gb:AY084886_15699680.004Arabidopsis thaliana clone 120231 mRNA, complete sequence.708011574 (2)gb:AY084886_15699682e-50Arabidopsis thaliana clone 120231 mRNA, complete sequence.
JMSF034C04Sequence656005165 (2)gb:AY084886_15699681e-15Arabidopsis thaliana clone 120231 mRNA, complete sequence.691011574 (2)gb:AY084886_15699681e-71Arabidopsis thaliana clone 120231 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034C04+ A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMSF034C04+ TCTGCATCAGTAGTTGCACATGCAAAATGCAGAACCAAAACCAGAGTAAATAAGTTTTTT
                      ____________________________________________________________
consensus TCTGCATCAGTAGTTGCACATGCAAAATGCAGAACCAAAACCAGAGTAAATAAGTTTTTT
 
. : . : . : . : . : . :
JMSF034C04+ TAAGACAATAAAGATATGATATGAATTAGATATTCAAAATGCTGTCAATTCTTGGAAACC
                      ____________________________________________________________
consensus TAAGACAATAAAGATATGATATGAATTAGATATTCAAAATGCTGTCAATTCTTGGAAACC
 
. : . : . : . : . : . :
JMSF034C04+ CCTATTCTCATTTCTCCATGATCAAACAGCATATATTCCAAAAAGCACAATTTAATCAAA
                      ____________________________________________________________
consensus CCTATTCTCATTTCTCCATGATCAAACAGCATATATTCCAAAAAGCACAATTTAATCAAA
 
. : . : . : . : . : . :
JMSF034C04+ AGTTTCCATGTACCCATATGCCTACTTATGTAGTGAACATTAATCATATACTGTGAAAGA
                      ____________________________________________________________
consensus AGTTTCCATGTACCCATATGCCTACTTATGTAGTGAACATTAATCATATACTGTGAAAGA
 
. : . : . : . : . : . :
JMSF034C04+ AGTGATGTTACCTGCTTAATTAATAGTTTAAGTACACATGCAAAAAGATTAAGAATGAAA
                      ____________________________________________________________
consensus AGTGATGTTACCTGCTTAATTAATAGTTTAAGTACACATGCAAAAAGATTAAGAATGAAA
 
. : . : . : . : . : . :
JMSF034C04+ GTGCAGCATATAGATCCAGAAGACAAGCAACAAAAACAAAAATATAGGAAACAGATAAAT
                      ____________________________________________________________
consensus GTGCAGCATATAGATCCAGAAGACAAGCAACAAAAACAAAAATATAGGAAACAGATAAAT
 
. : . : . : . : . : . :
JMSF034C04+ ACTTACACCACTTTTGGAGAGGTGCATAGGTTAAGCATTTGCCAGAAAGTATATTCAATG
                      ____________________________________________________________
consensus ACTTACACCACTTTTGGAGAGGTGCATAGGTTAAGCATTTGCCAGAAAGTATATTCAATG
 
. : . : . : . : . : . :
JMSF034C04+ TCCATTTGTTGCCACTTGACTATTCTGCGGATGTATTGAGGGAAAACGGGATTCTGTCGA
JMSF010I01+ CTTGACTATTCTGCGGATGTATTGAGGGAAAACGGGATTCTGTCGA
                      ____________________________________________________________
consensus TCCATTTGTTGCCACTTGACTATTCTGCGGATGTATTGAGGGAAAACGGGATTCTGTCGA
 
. : . : . : . : . : . :
JMSF034C04+ GCATAAGAGCTCGTTCGCCCTTTCGATGAATTGGTGGGAAGCATCTTCTCCTTCTCCTTC
JMSF010I01+ GCATAAGAGCTCGTTCGCCCTTTCGATGAATTGGTGGGAAGCATCTTCTCCTTCTCCTTC
                      ____________________________________________________________
consensus GCATAAGAGCTCGTTCGCCCTTTCGATGAATTGGTGGGAAGCATCTTCTCCTTCTCCTTC
 
. : . : . : . : . : . :
JMSF034C04+ TCCTTCTCCTTCTTCTTCTCCTTCTTCTTCTTCTCCTTCTTCTCCTTCTCCGGCGGTCGT
JMSF010I01+ TCCTTCTCCTTCTTCTTCTCCTTCTTCTTCTTCTCCTTCTTCTTCTTCTCCGGCGGTCGT
                      ____________________________________________________________
consensus TCCTTCTCCTTCTTCTTCTCCTTCTTCTTCTTCTCCTTCTTCTTCTTCTCCGGCGGTCGT
 
. : . : . : . : . : . :
JMSF034C04+ TGATCGGAGAACTAATCAGTTTCTGCAACCTCTATTCTGTTTCTCTCTCTCTCTC
JMSF010I01+ TGATCGGAGAACTAATCAGTTTCTGCAACCTCTATTCTGTTTCTCTCTCTCTCTCGACCC
                      ____________________________________________________________
consensus TGATCGGAGAACTAATCAGTTTCTGCAACCTCTATTCTGTTTCTCTCTCTCTCTCGACCC