Previous Contig 005160:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010H10Sequence446005160 (2)gb:OSA243828_16923811e-47Oryza sativa mRNA for protein phosphatase 2A regulatory A subunit (RPA1 gene).>g725003613 (3)gb:AB028607_15178994e-80Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K13N2.>gb:BT002488_163
JMSF017E20Sequence251005160 (2)gb:ATU27299_15568694e-11Arabidopsis thaliana serine/threonine protein phosphatase type 2A regulatory sub714003613 (3)gb:AB028607_15178994e-83Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K13N2.>gb:BT002488_163

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF010H10+ TCACACAGGTCTCCTCCACTGAGCAA
                      ____________________________________________________________
consensus TCACACAGGTCTCCTCCACTGAGCAA
 
. : . : . : . : . : . :
JMSF010H10+ AGTGTCTCTAAGGGCGGGAGCAACACATGAGCATGCTCCACACCTCCAACATAAGGAATA
                      ____________________________________________________________
consensus AGTGTCTCTAAGGGCGGGAGCAACACATGAGCATGCTCCACACCTCCAACATAAGGAATA
 
. : . : . : . : . : . :
JMSF010H10+ AACACAGCTAACTCTTCTGCCATTGCAAGCAACACCTCATCATCGTCATCATTGTTCTCA
                      ____________________________________________________________
consensus AACACAGCTAACTCTTCTGCCATTGCAAGCAACACCTCATCATCGTCATCATTGTTCTCA
 
. : . : . : . : . : . :
JMSF017E20+ GCACGTGCTATAGTA
JMSF010H10+ CTCAGGAATGGGATTAACTCCTTCCGAGTTCTTTCCTCCCCAAGTGCACGTGCTATAGTA
                      ____________________________________________________________
consensus CTCAGGAATGGGATTAACTCCTTCCGAGTTCTTTCCTCCCCAAGTGCACGTGCTATAGTA
 
. : . : . : . : . : . :
JMSF017E20+ GATAGCCTCCGGACAGAATTCAACCGCAGTTGAATGTCATCATTCTTTAGCTCCTCTATC
JMSF010H10+ GATAGCCTCCGGACAGAATTCAACCGCAGTTGAATGTCATCATTCTTTAGCTCCTCTATC
                      ____________________________________________________________
consensus GATAGCCTCCGGACAGAATTCAACCGCAGTTGAATGTCATCATTCTTTAGCTCCTCTATC
 
. : . : . : . : . : . :
JMSF017E20+ AACACAGCTATTGGGTACAGTGGCTCGACAGCCATTGCCATTGTGTCGTCAAAATTTACT
JMSF010H10+ AACACAGCTATTGGGTACAGTGGCTCGTCAGCCATTGCCATTGTGTCGTCAAAATTTACT
                      ____________________________________________________________
consensus AACACAGCTATTGGGTACAGTGGCTCGTCAGCCATTGCCATTGTGTCGTCAAAATTTACT
 
. : . : . : . : . : . :
JMSF017E20+ CGCAGCGGAGGAAATGAGCTCCCGCCAGCCGGCGCCTGAGATTCGAAGTTGTCGTTGTTT
JMSF010H10+ CGCAGCGGAGGAAATGAGCTCCCGCCAGCCGGCGCCTGAGATTCGAAGTTGTCGTTGTTT
                      ____________________________________________________________
consensus CGCAGCGGAGGAAATGAGCTCCCGCCAGCCGGCGCCTGAGATTCGAAGTTGTCGTTGTTT
 
. : . : . : . : . : . :
JMSF017E20+ CTTTCGCCGGAGATACAAAGAGAATGTGTTGAATAGGTCGTGGTATTTTGAAT
JMSF010H10+ CTTTCGCCGGAGATACAAAGAGAATGTGTTGAATAGGTCGTGGTATTTTGAATTCCGTCC
                      ____________________________________________________________
consensus CTTTCGCCGGAGATACAAAGAGAATGTGTTGAATAGGTCGTGGTATTTTGAATTCCGTCC