Previous Contig 005158:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038H12Sequence615005158 (2)sp|P04715|RBS2_PETHY2e-48Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF010H03Sequence361005158 (2)sp|P04715|RBS2_PETHY1e-14Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 699011569 (3)sp|P04715|RBS2_PETHY2e-54Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN038H12+ CCGCAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGCTTC
                      ____________________________________________________________
consensus CCGCAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGCTTC
 
. : . : . : . : . : . :
JMFN038H12+ CACATGGTCCAGTATCTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACG
                      ____________________________________________________________
consensus CACATGGTCCAGTATCTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACG
 
. : . : . : . : . : . :
JMFN038H12+ AATCCTTTCTGCACCCCGACCCATCAAAACTAAAAGTTTACACTAAATCAAATTAAATTA
                      ____________________________________________________________
consensus AATCCTTTCTGCACCCCGACCCATCAAAACTAAAAGTTTACACTAAATCAAATTAAATTA
 
. : . : . : . : . : . :
JMFN038H12+ AATAATAGAGTAGTAGTAGTTGATTTTGACCTCGGTCTCGAATTCCAAGCAAGGAACCCA
                      ____________________________________________________________
consensus AATAATAGAGTAGTAGTAGTTGATTTTGACCTCGGTCTCGAATTCCAAGCAAGGAACCCA
 
. : . : . : . : . : . :
JMFN038H12+ TCCCTTGTTCAAAAGGTACTCCACTTGTTTGAGCAATTGCTCGGTGCTCAAGGGAGGCAG
JMSF010H03+ G
                      ____________________________________________________________
consensus TCCCTTGTTCAAAAGGTACTCCACTTGTTTGAGCAATTGCTCGGTGCTCAAGGGAGGCAG
 
. : . : . : . : . : . :
JMFN038H12+ GTATGACAGGGTCTCGAACTTCTTCAACCCGAATGGGGGCCACACCTGAACTCACATATA
JMSF010H03+ GTATGACAGGGTCTCGAACTTCTTCAACCCGAATGGGGGCCACACCTGAACTCACATATA
                      ____________________________________________________________
consensus GTATGACAGGGTCTCGAACTTCTTCAACCCGAATGGGGGCCACACCTGAACTCACATATA
 
. : . : . : . : . : . :
JMFN038H12+ TATACGGCATAGTTAACTCAGTACACACCATCATACAGTAACAGTTAAAGTTCACTTAAG
JMSF010H03+ TATACGGCATAGTTAACTCAGTACACACCATCATACAGTAACAGTTAAAGTTCACTTAAG
                      ____________________________________________________________
consensus TATACGGCATAGTTAACTCAGTACACACCATCATACAGTAACAGTTAAAGTTCACTTAAG
 
. : . : . : . : . : . :
JMFN038H12+ TGTATATATATTAGTATACCTGCATGCATTGTACTCGGCTACCGTTGGTGGAGATGGAAG
JMSF010H03+ TGTATATATATTAGTATACCTGCATGCATTGTACTCGGCTACCGTTGGTGGAGATGGAAG
                      ____________________________________________________________
consensus TGTATATATATTAGTATACCTGCATGCATTGTACTCGGCTACCGTTGGTGGAGATGGAAG
 
. : . : . : . : . : . :
JMFN038H12+ TAAAGTCGGCGGCGGACTTCTTGGTGACGGGGAAGGAGGCGGTGGACTTGAGGCCGGTGA
JMSF010H03+ TAAAGTCGGCGGCGGACTTCTTGGTGACGGGGAAGGAGGCGGTGGACTTGAGGCCGGTGA
                      ____________________________________________________________
consensus TAAAGTCGGCGGCGGACTTCTTGGTGACGGGGAAGGAGGCGGTGGACTTGAGGCCGGTGA
 
. : . : . : . : . : . :
JMFN038H12+ AGGGGGCGACCATGCTGGCTTGGGCAGCGGTGGCGCGGGAGGCGATGGCGGTGGAGGAGA
JMSF010H03+ AGGGGGCGACCATGCTGGCTTGGGCAGCGGTGGCGCGGGAGGCGATGGCGGTGGAGGAGA
                      ____________________________________________________________
consensus AGGGGGCGACCATGCTGGCTTGGGCAGCGGTGGCGCGGGAGGCGATGGCGGTGGAGGAGA
 
. : . : . : . : . : . :
JMFN038H12+ GGACTGAGGAGGCCATTGCTAGCTGCCT
JMSF010H03+ GGACTGAGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTGTTACTTTGTAATC
                      ____________________________________________________________
consensus GGACTGAGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTGTTACTTTGTAATC