Previous Contig 005152:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011N03Sequence548005152 (7)pir|T04014|T040143e-48hypothetical protein F17A8.20 - Arabidopsis thaliana>gb:ATCHRIV27_1544681 Arabid499005152 (7)gb:AY045851_15613632e-31Arabidopsis thaliana putative AX110P protein (At4g09670) mRNA, partial cds.
JMFN007O03Sequence625005152 (7)gb:AY045851_15613636e-44Arabidopsis thaliana putative AX110P protein (At4g09670) mRNA, partial cds.
JMSF002C16Sequence240005152 (7)pir|T04014|T040144e-18hypothetical protein F17A8.20 - Arabidopsis thaliana>gb:ATCHRIV27_1544681 Arabid769005152 (7)gb:AY045851_15613632e-59Arabidopsis thaliana putative AX110P protein (At4g09670) mRNA, partial cds.
JMSF010G05Sequence372005152 (7)pir|T04014|T040144e-30hypothetical protein F17A8.20 - Arabidopsis thaliana>gb:ATCHRIV27_1544681 Arabid721005152 (7)gb:AY045851_15613636e-44Arabidopsis thaliana putative AX110P protein (At4g09670) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011N03- TATGATTTATAAATAAATTTCCTCCCATACAAAGTGGCAGATTACAAA
rJMSF010G05- GTGGCAGATTACAAA
rJMSF002C16- GTGGCAGATTACAAA
                      ____________________________________________________________
consensus TATGATTTATAAATAAATTTCCTCCCATACAAAGTGGCAGATTACAAA
 
. : . : . : . : . : . :
rJMFF011N03- TTGTGCTGAATTTACAATTTAGAGCCATCTACATATGAACAGGTTGGAAACCAAGGTCTA
rJMSF010G05- TTGTGCTGAATTTACAATTTAGAGCCATCTACATATGAACAGGTTGGAAACCAAGGTCTA
JMFN007O03+ AGCCATCTACATATGAACAGGTTGGAAACCAAGGTCTA
rJMSF002C16- TTGTGCTGAATTTACAATTTAGAGCCATCTACATATGAACAGGTTGGAAACCAAGGTCTA
                      ____________________________________________________________
consensus TTGTGCTGAATTTACAATTTAGAGCCATCTACATATGAACAGGTTGGAAACCAAGGTCTA
 
. : . : . : . : . : . :
rJMFF011N03- TAGAATTTTTAACAGCATCCAGCACTAGTTGAGTCAATCTGCTGCTGTGAGGCCACTTGT
rJMSF010G05- TAGAATTTTTAACAGCATCCAGCACTAGTTGAGTCAATCTGCTGCTGTGAGGCCACTTGT
JMFN007O03+ TAGAATTTTTAACAGCATCCAGCACTAGTTGAGTCAATCTGCTGCTGTGAGGCCACTTGT
rJMSF002C16- TAGAATTTTTAACAGCATCCAGCACTAGTTGAGTCAATCTGCTGCTGTGAGGCCACTTGT
                      ____________________________________________________________
consensus TAGAATTTTTAACAGCATCCAGCACTAGTTGAGTCAATCTGCTGCTGTGAGGCCACTTGT
 
. : . : . : . : . : . :
rJMFF011N03- GCTCTGGTTTTCTTCCCAAGAATTTGATGGCATTCACTAGCTCAGAGAACTCCATAACCA
rJMSF010G05- GCTCTGGTTTTCTTCCCAAGAATTTGATGGCATTCACTAGCTCAGAGAACTCCATAACCA
JMFN007O03+ GCTCTGGTTTTCTTCCCAAGAATTTGATGGCATTCACTAGCTCAGAGAACTCCATAACCA
rJMSF002C16- GCTCTGGTTTTCTTCCCAAGAATTTGATGGCATTCACTAGCTCAGAGAACTCCATAACCA
                      ____________________________________________________________
consensus GCTCTGGTTTTCTTCCCAAGAATTTGATGGCATTCACTAGCTCAGAGAACTCCATAACCA
 
. : . : . : . : . : . :
rJMFF011N03- TCATAGCTTCTTGGGGCAACTGTGAAGCCACATGAACCTCCTCAGGTTGAGCATTCCACC
rJMSF010G05- TCATAGCTTCTTGGGGCAACTGTGAAGCCACATGAACCTCCTCAGGTTGAGCATTCCACC
JMFN007O03+ TCATAGCTTCTTGGGGCAACTGTGAAGCCACATGAACCTCCTCAGGTTGAGCATTCCACC
rJMSF002C16- TCATAGCTTCTTGGGGCAACTGTGAAGCCACATGAACCTCCTCAGGTTGAGCATTCCACC
                      ____________________________________________________________
consensus TCATAGCTTCTTGGGGCAACTGTGAAGCCACATGAACCTCCTCAGGTTGAGCATTCCACC
 
. : . : . : . : . : . :
rJMFF011N03- CGACGTGGAGATCCAAAAACTTAGAACCAGAAGCGAAACTAAAGGCAGCAGACGTCTCTT
rJMSF010G05- CGACGTGGAGATCCAAAAACTTAGAACCAGAAGCGAAACTAAAGGCAGCAGACGTCTCTT
JMFN007O03+ CGACGTGGAGATCCAAAAACTTAGAACCAGAAGCGAAACTAAAGGCAGCAGACGTCTCTT
rJMSF002C16- CGACGTGGAGATCCAAAAACTTAGAACCAGAAGCGAAACTAAAGGCAGCAGACGTCTCTT
                      ____________________________________________________________
consensus CGACGTGGAGATCCAAAAACTTAGAACCAGAAGCGAAACTAAAGGCAGCAGACGTCTCTT
 
. : . : . : . : . : . :
rJMFF011N03- CAAAGGGGATTATGAAGTCATTGACACAGAGCGATCCCTTGGAGCCACAGACTAGTATGT
rJMSF010G05- CAAAGGGGATTATGAAGTCATTGACACAGAGCGATCCCTTGGAGCCACAGACTAGTATGT
JMFN007O03+ CAAAGGGGATTATGAAGTCATTGACACAGAGCGATCCCTTGGAGCCACAGACTAGTATGT
rJMSF002C16- CAAAGGGGATTATGAAGTCATTGACACAGAGCGATCCCTTGGAGCCACAGACTAGTATGT
                      ____________________________________________________________
consensus CAAAGGGGATTATGAAGTCATTGACACAGAGCGATCCCTTGGAGCCACAGACTAGTATGT
 
. : . : . : . : . : . :
rJMFF011N03- CCATCGACTCGTGTGCAAGAAAGGAGCAGAAAAATGTTGCAACAGTTCCTTCATCCCAGT
rJMSF010G05- CCATCGACTCGTGTGCAAGAAAGGAGCAGAAAAATGTTGCAACAGTTCCTTCATCCCAGT
JMFN007O03+ CCATCGACTCGTGTGCAAGAAAGGAGCAGAAAAATGTTGCAACAGTTCCTTCATCCCAGT
rJMSF002C16- CCATCGACTCGTGTGCAAGAAAGGAGCAGAAAAATGTTGCAACAGTTCCTTCATCCCAGT
                      ____________________________________________________________
consensus CCATCGACTCGTGTGCAAGAAAGGAGCAGAAAAATGTTGCAACAGTTCCTTCATCCCAGT
 
. : . : . : . : . : . :
rJMFF011N03- ATAAAGATGCGCTGCATGCCAATATGACCCC
rJMSF010G05- ATAAAGATGCGCTGCATGCCAATATGACCCCGGCTGAGTTTTTCTCTATAGCAGGCAGCG
JMFN007O03+ ATAAAGATGCGCTGCATGCCAATATGACCCCGGCTGAGTTTTTCTCTATAGCAGGCAGCG
rJMSF002C16- ATAAAGATGCGCTGCATGCCAATATGACCCCGGCTGAGTTTTTCTCTATAGCAGGCAGCG
                      ____________________________________________________________
consensus ATAAAGATGCGCTGCATGCCAATATGACCCCGGCTGAGTTTTTCTCTATAGCAGGCAGCG
 
. : . : . : . : . : . :
rJMSF010G05- CAACCACAGTTGTTGGCAGCTTTTGGTTCATAGCCCACAATATGGAACCAATGCAGTACC
JMFN007O03+ CAACCACAGTTGTTGGCAGCTTTTGGTTCATAGCCCACAATATGGAACCAATGCAGTACC
rJMSF002C16- CAACCACAGTTGTTGGCAGCTTTTGGTTCATAGCCCACAATATGGAACCAATGCAGTACC
                      ____________________________________________________________
consensus CAACCACAGTTGTTGGCAGCTTTTGGTTCATAGCCCACAATATGGAACCAATGCAGTACC
 
. : . : . : . : . : . :
rJMSF010G05- ATCCAGCGTCTCCCAGTGCGCCTAGGGCATCCAAGTCCGGTTTCACTCTTATGTCGTTTT
JMFN007O03+ ATCCAGCGTCTCCCAGTGCGCCTAGGGCATCCAAGTCCGGTTTCACTCTTACGTCGTTTT
rJMSF002C16- ATCCAGCGTCTCCCAGTGCGCCTAGGGCATCCAAGTCCGGTTTCACTCTTATGTCGTTTT
JMFF011N03+ CGTTTT
                      ____________________________________________________________
consensus ATCCAGCGTCTCCCAGTGCGCCTAGGGCATCCAAGTCCGGTTTCACTCTTATGTCGTTTT
 
. : . : . : . : . : . :
rJMSF010G05- CAAGAAATGCTGGAGGTGCTGCATAAGATGATGAGCTGTGGATC
JMFN007O03+ CAAGAAATGCTGGAGGTGCTGCATAAGATGATGAGCTGTGGATC
rJMSF002C16- CAAGAAATGCTGGAGGTGCTGCATAAGATGATGAGCTGTGGATCGAGTTGACTTGTCCGA
JMFF011N03+ CAAGAAATGCTGGAGGTGCTGCATAAGATGATGAGCTGTGGATCGAGTTGACTTGTCCGA
                      ____________________________________________________________
consensus CAAGAAATGCTGGAGGTGCTGCATAAGATGATGAGCTGTGGATCGAGTTGACTTGTCCGA
 
. : . : . : . : . : . :
rJMSF002C16- AGATGTCAGAATCGGATAGAAATTCCTTCATCTTGGCAGTCCTAGGATGATGATACCACA
JMFF011N03+ AGATGTCAGAATCGGATAGAAATTCCTTCATCTTGGCAGTCCTAGGATGATGATACCACA
                      ____________________________________________________________
consensus AGATGTCAGAATCGGATAGAAATTCCTTCATCTTGGCAGTCCTAGGATGATGATACCACA
 
. : . : . : . : . : . :
rJMSF002C16- TGCTAGCATCCATAAACTGAACCCCATTTTTCTC
JMFF011N03+ TGCTAGCATCCATAAACTGAACCCCATTTTTCTCACAGGCATCAAGAATCTTATCGAGCT
                      ____________________________________________________________
consensus TGCTAGCATCCATAAACTGAACCCCATTTTTCTCACAGGCATCAAGAATCTTATCGAGCT
 
. : . : . : . : . : . :
JMFF011N03+ CATCCACGTTNCAGGGCAGTAGGTTTCTCAAGCAGCAAGTGCTTCTTCTTCTCCGCAGCC
JMSF010G05+ TTCTCCGCAGCC
                      ____________________________________________________________
consensus CATCCACGTTNCAGGGCAGTAGGTTTCTCAAGCAGCAAGTGCTTCTTCTTCTCCGCAGCC
 
. : . : . : . : . : . :
JMFF011N03+ AAGACTGCCCAATGGGCGTGAAGGCTTGTCGGAAGCGGCATGTAAACTGCATCCACCGAC
JMSF010G05+ AAGACTGCCCAATGGGCGTGAAGGCTTGTCGGAAGCGGCATGTAAACTGCATCCACCGAC
                      ____________________________________________________________
consensus AAGACTGCCCAATGGGCGTGAAGGCTTGTCGGAAGCGGCATGTAAACTGCATCCACCGAC
 
. : . : . : . : . : . :
JMFF011N03+ GGGTCATCAAGCAATTCGTTGTAGCTGCCGTAGATCTTAACCGTTTCTGCTAAGCCATTC
JMSF002C16+ TCATCAAGCAATTCGTNGTAGCTGCCGTAGATCTTAACCGTTTCTGCTAAGCCATTC
JMSF010G05+ GGGTCATCAAGCAATTCGTTGTAGCTGCCGTAGATCTTAACCGTTTCTGCTAAGCCATTC
                      ____________________________________________________________
consensus GGGTCATCAAGCAATTCGTTGTAGCTGCCGTAGATCTTAACCGTTTCTGCTAAGCCATTC
 
. : . : . : . : . : . :
JMFF011N03+ TTGACTGCAAACTGCTTCGCTTTGTGCACTGAACGGCTAGCGACGGCGTGAAGAGTGGCG
JMSF002C16+ TTGACTGCAAACTGCTTCGCTTTGTGCACTGAACGGCTAGCGACGGCGTGAAGAGTGGCG
JMSF010G05+ TTGACTGCAAACTGCTTCGCTTTGTGCACTGAACGGCTAGCGACGGCGTGAAGAGTGGCG
                      ____________________________________________________________
consensus TTGACTGCAAACTGCTTCGCTTTGTGCACTGAACGGCTAGCGACGGCGTGAAGAGTGGCG
 
. : . : . : . : . : . :
JMFF011N03+ TTGGGGGCTAGGTGTATGGCTCTGGAGACCTTTCTTGCTATCTCAGCGCACCCCATTATG
JMSF002C16+ TTGGGGGCTAGGTGTATGGCTCTGGAGACCTTTCTTGCTATCTCAGCGCACCCCATTATG
JMSF010G05+ TTGGGGGCTAGGTGTATGGCTCTGGAGACCTTTCTTGCTATCTCAGCGCACCCCATTATG
                      ____________________________________________________________
consensus TTGGGGGCTAGGTGTATGGCTCTGGAGACCTTTCTTGCTATCTCAGCGCACCCCATTATG
 
. : . : . : . : . : . :
JMFF011N03+ CCAAAACGAATTGTGCTCTCCTCGGCCATTTTCCTCCCTTCCCGGAACGCATTCAACTAT
JMSF002C16+ CCAAAACGAATTGTGCTCTCCTCGGCCATTTTCCTCCCTTCCCGGAACGCATTCAACTAT
JMSF010G05+ CCAAAACGAATTGTGCTCTCCTCGGCCATTTTCCTCCCTTCCCGGAACGCATTCAACTAT
                      ____________________________________________________________
consensus CCAAAACGAATTGTGCTCTCCTCGGCCATTTTCCTCCCTTCCCGGAACGCATTCAACTAT
 
. : . : . : . : . : . :
JMSF010G05+ TCAAGCACAGAGTTTAACTCTTTGATGATTTTGTAACCTTCATTTTGGATTTTGGATTCC
                      ____________________________________________________________
consensus TCAAGCACAGAGTTTAACTCTTTGATGATTTTGTAACCTTCATTTTGGATTTTGGATTCC