Previous Contig 005146:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS062D02Sequence611005146 (2)gb:AY550923_16133172e-76Arabidopsis thaliana putative DNA repair and transcription factor XBP2 (XPB2) an
JMSF010E20Sequence454005146 (2)gb:AY550923_16133172e-41Arabidopsis thaliana putative DNA repair and transcription factor XBP2 (XPB2) an698009232 (2)gb:AY550923_16133177e-82Arabidopsis thaliana putative DNA repair and transcription factor XBP2 (XPB2) an

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS062D02+ GACCGACCTATAACTTCATCTCGAAGCAACGTTTTCAGTACCTCAGGAAA
                      ____________________________________________________________
consensus GACCGACCTATAACTTCATCTCGAAGCAACGTTTTCAGTACCTCAGGAAA
 
. : . : . : . : . : . :
JMFS062D02+ TGGAGATTCAATAAAATACCGGTTCTTCTTAAGCACGAGCTTCACTTTGCCATAGTTGGC
                      ____________________________________________________________
consensus TGGAGATTCAATAAAATACCGGTTCTTCTTAAGCACGAGCTTCACTTTGCCATAGTTGGC
 
. : . : . : . : . : . :
JMFS062D02+ AGTAGAAGCATGTATAAAATCAATCATCTCTTTCGGAAGCTTAGTTTTTGACAATTTGCT
                      ____________________________________________________________
consensus AGTAGAAGCATGTATAAAATCAATCATCTCTTTCGGAAGCTTAGTTTTTGACAATTTGCT
 
. : . : . : . : . : . :
JMFS062D02+ TAAAACAGATATTATAGTTTCAGTCTCCAAACCAACGGACACAGCCGCATACAAAGAGTG
JMSF010E20+ CCAAACCAACGGACACAGCCGCATACAAAGAGTG
                      ____________________________________________________________
consensus TAAAACAGATATTATAGTTTCAGTCTCCAAACCAACGGACACAGCCGCATACAAAGAGTG
 
. : . : . : . : . : . :
JMFS062D02+ AGGTGTCAAATTGTACTCATGCATAGACTCCGGCCTGCAAACAGGTTCAGCAATGGCTAT
JMSF010E20+ AGGTGTCAAATTGTACTCATGCATAGACTCCGGCCTGCAAACAGGTTCAGCAATGGCTAT
                      ____________________________________________________________
consensus AGGTGTCAAATTGTACTCATGCATAGACTCCGGCCTGCAAACAGGTTCAGCAATGGCTAT
 
. : . : . : . : . : . :
JMFS062D02+ GAGAAAGTCATATGCCTGTTTGTATAATGCTGAGAATGTTTCGAGGAAAATCCTACCATC
JMSF010E20+ GAGAAAGTCATATGCCTGTTTGTATAATGCTGAGAATGTTTCGAGGAAAATCCTACCATC
                      ____________________________________________________________
consensus GAGAAAGTCATATGCCTGTTTGTATAATGCTGAGAATGTTTCGAGGAAAATCCTACCATC
 
. : . : . : . : . : . :
JMFS062D02+ AGCACAAGCCCACAAAGGGCGATTACCGTGATCAAGTTTGAGTTCAAGTTTCGTGAAATC
JMSF010E20+ AGCAAAAGCCCACAAAGGGCGATTACCGTGATCAAGTTTGAGTTCAAGTTTCGTGAAATC
                      ____________________________________________________________
consensus AGCACAAGCCCACAAAGGGCGATTACCGTGATCAAGTTTGAGTTCAAGTTTCGTGAAATC
 
. : . : . : . : . : . :
JMFS062D02+ TCTTTTCTTCCCTTCACCCTCTCCATCACGAGGATCATCATTGATTTCATCTGGATAATA
JMSF010E20+ TCTTTTCTTCCCTTCACCCTCTCCATCACGAGGATCATCATTGATTTCATCTGGATAATA
                      ____________________________________________________________
consensus TCTTTTCTTCCCTTCACCCTCTCCATCACGAGGATCATCATTGATTTCATCTGGATAATA
 
. : . : . : . : . : . :
JMFS062D02+ CGAATCATCTGTTTCAGCAGACCTAAATTCCTCCTTCGAGGAAAACTTGAACTTTTTGCT
JMSF010E20+ CGAATCATCTGTTTCAGCAGACCTAAATTCCTCCTTCGAGGAAAACTTGAACTTTTTGCT
                      ____________________________________________________________
consensus CGAATCATCTGTTTCAGCAGACCTAAATTCCTCCTTCGAGGAAAACTTGAACTTTTTGCT
 
. : . : . : . : . : . :
JMFS062D02+ GGGTCGACCTTTATCACCGTGATGACCCATCGTTTCAACTTTGAGATCGAGCAACAATGG
JMSF010E20+ GGGTCGACCTTTATCACCGTGATGACCCATCGTTTCAACTTTGAGATCGAGCAACAATGG
                      ____________________________________________________________
consensus GGGTCGACCTTTATCACCGTGATGACCCATCGTTTCAACTTTGAGATCGAGCAACAATGG
 
. : . : . : . : . : . :
JMFS062D02+ CTGTTTCCGTGCTGAGTGTCT
JMSF010E20+ CTGTTTCCGTGCTGAGTGTCTGATCACAACAGTTATCTGCGTGAGTTATCGTCAAATGCC
                      ____________________________________________________________
consensus CTGTTTCCGTGCTGAGTGTCTGATCACAACAGTTATCTGCGTGAGTTATCGTCAAATGCC