Previous Contig 005138:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007N02Sequence382005138 (5)gb:AY050870_15623655e-26Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete744002505 (5)gb:AY050870_15623652e-88Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF010D08Sequence247005138 (5)692002505 (5)gb:AY050870_15623651e-92Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF013K22Sequence236005138 (5)gb:AY050870_15623657e-07Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete767002505 (5)gb:AY050870_15623651e-91Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF045D13Sequence748005138 (5)gb:AY050870_15623652e-42Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete
JMSF051A13Sequence656005138 (5)gb:AY050870_15623651e-30Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete750002505 (5)gb:AY050870_15623653e-89Arabidopsis thaliana putative receptor protein kinase (At2g26730) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF007N02+ GGATAGTGTAGT
                      ____________________________________________________________
consensus GGATAGTGTAGT
 
. : . : . : . : . : . :
JMSF007N02+ GGGAATAGACCCATTTAGGCGATTGTTCGAAACATTGAAATCAGTTAACCTTAAAGGATT
JMSF045D13+ GGATT
                      ____________________________________________________________
consensus GGGAATAGACCCATTTAGGCGATTGTTCGAAACATTGAAATCAGTTAACCTTAAAGGATT
 
. : . : . : . : . : . :
JMSF007N02+ GATGCTAGGGAGTGTCCCATTAAAGCCATTGTTCTGCAAGTAAAGCCGAGTCAAATTGCT
JMSF045D13+ GATGNTAGGGAGTGTCCCATTAAAGCCATTGTTTTGCAAGTAAAGCCGAGTCAAATTGCT
                      ____________________________________________________________
consensus GATGCTAGGGAGTGTCCCATTAAAGCCATTGTTTTGCAAGTAAAGCCGAGTCAAATTGCT
 
. : . : . : . : . : . :
JMSF007N02+ TAAATTGTTGACGGCGAACGGGATTGGCCCGGAAAAGTTGTTAGATGACATGTCAAGGCG
JMSF051A13+ CGGAAAAGTTGTTAGATGACATGTCAAGGCG
JMSF013K22+ CGGAAAAGTTGTTAGATGACATGTCAAGGCG
JMSF045D13+ TAAATTGTTGACGGCGAACGGGATTGGCCCGGAAAAGTTGTTAGATGACATGTCAAGGCG
                      ____________________________________________________________
consensus TAAATTGTTGACGGCGAACGGGATTGGCCCGGAAAAGTTGTTAGATGACATGTCAAGGCG
 
. : . : . : . : . : . :
JMSF007N02+ GATAAGTCGGGTCACCCCGGTGATACTCGCCGGAAACCCGCCGGAGAGCAAGTTGTTCTG
JMSF051A13+ GATAAGTCGGGTCACCCCGGTGATACTCGCCGGAAACCCGCCGGAGAGCAAGTTGTTCTG
JMSF013K22+ GATAAGTCGGGTCACCCCGGTGATACTCGCCGGAAACCCGCCGGAGAGCAAGTTGTTCTG
JMSF045D13+ GATAAGTCGGGTCACCCCGGTGATACTCGCCGGAAACCCGCCGGAGAGCAAGTTGTTCTG
                      ____________________________________________________________
consensus GATAAGTCGGGTCACCCCGGTGATACTCGCCGGAAACCCGCCGGAGAGCAAGTTGTTCTG
 
. : . : . : . : . : . :
JMSF007N02+ GAGATAGAGGCTACGGAGGAGCTTGAGGTTAGAGAAATCCTGCGGGATTGGACCGGTGAG
JMSF051A13+ GAGATAGAGGCTACGGAGGAGCTTGAGGTTAGAGAAATCNTGCGGGATTGGACCGGTGAG
JMSF013K22+ GAGATAGAGGCTACGGAGGAGCTTGAGGTTAGAGAAATCCTGCGGGATTGGACCGGTGAG
JMSF045D13+ GAGATAGAGGCTACGGAGGAGCTTGAGGTTAGAGAAATCNTGCGGGATTGGACCGGTGAG
                      ____________________________________________________________
consensus GAGATAGAGGCTACGGAGGAGCTTGAGGTTAGAGAAATCCTGCGGGATTGGACCGGTGAG
 
. : . : . : . : . : . :
JMSF007N02+ CCGGTTGGACCGGAGGCTAAGAACCCGAAGCCGGCTCAGGCGTCCCAGCGTATTCGCCGG
JMSF051A13+ CCGGTTGGACCGGAGGCTAAGAACCCGAAGCCGGCTCAGGCGTCCCAGCGTATTCGCCGG
JMSF013K22+ CCGGTTGGACCGGAGGCTAAGAACCCGAAGCCGGCTCAGGCGTCCCAGCGTATTCGCCGG
JMSF045D13+ CCGGTTGGACCGGAGGCTAAGAACCCGAAGCCGGCTCAGGCGTCCCAGCGTATTCGCCGG
                      ____________________________________________________________
consensus CCGGTTGGACCGGAGGCTAAGAACCCGAAGCCGGCTCAGGCGTCCCAGCGTATTCGCCGG
 
. : . : . : . : . : . :
JMSF007N02+ AATATTCCCC
JMSF051A13+ AATATTCCCCACCAAGCCGACGCCGGGAAGCCGGAGAGCGAATACAAACGACTGGTTATC
JMSF013K22+ AATATTCCCCACCAAGCCGACGCC
JMSF045D13+ AATATTCCCCACCAAGCCGACGCCGGGAAGCCGGAGAGCGAATACAAACGACTGGTTATC
                      ____________________________________________________________
consensus AATATTCCCCACCAAGCCGACGCCGGGAAGCCGGAGAGCGAATACAAACGACTGGTTATC
 
. : . : . : . : . : . :
JMSF051A13+ ATCACATCGCACGCCCACCCACGTGCACGCAGAGACGGAGGCGTTCCACTGGACCCTGCC
JMSF045D13+ ATCACATTGCACGCCCACCCACGTGCACGCAGAGACGGAGGCGTTCCACTGGACCCTGCC
                      ____________________________________________________________
consensus ATCACATTGCACGCCCACCCACGTGCACGCAGAGACGGAGGCGTTCCACTGGACCCTGCC
 
. : . : . : . : . : . :
JMSF051A13+ CTCGTGTGGGACCCTCGACAGGAAAGCAAGGAGTGCTTGCTTGTCCTGAGTTGGCTCCGA
JMSF045D13+ CTCGTGTGGGACCCTCGACAGGAAAGCAAGGAGTGCTTGCTTGTCCTGAGTTGGCTCCGA
                      ____________________________________________________________
consensus CTCGTGTGGGACCCTCGACAGGAAAGCAAGGAGTGCTTGCTTGTCCTGAGTTGGCTCCGA
 
. : . : . : . : . : . :
JMSF051A13+ GTTGACGCGGTGGTGGTGACTCACCTGTAACGCCACCACCATAGCAAACCACAGAAGAAA
JMSF045D13+ GTTGACGCGGTGGTGGTGACTCACCTGTAACGCCACCACCATAGCAAACCACAGAAGAAA
JMSF010D08+ GAAGAAA
                      ____________________________________________________________
consensus GTTGACGCGGTGGTGGTGACTCACCTGTAACGCCACCACCATAGCAAACCACAGAAGAAA
 
. : . : . : . : . : . :
JMSF051A13+ CCAAGAATTCAAAATCGCCGCCATAATATTCTTCTTTTTGCACCAAAAACTCTACGCCAA
JMSF045D13+ CCAAGAATTCAAAATCGCCGCCATAATATTCTTCTTTTTGCACCAAAAACTCTACGCCAA
JMSF010D08+ CCAAGAATTCAAAATCGCCGCCATAATATTCTTCTTTTTGCACCAAAAACTCTACGCCAA
                      ____________________________________________________________
consensus CCAAGAATTCAAAATCGCCGCCATAATATTCTTCTTTTTGCACCAAAAACTCTACGCCAA
 
. : . : . : . : . : . :
JMSF051A13+ AATTCTTATTTAATTCTTAAACAGCTGCACTTCTGGACTGATTCAAAACCCGGCCGCCGG
JMSF045D13+ AATTCTTATTTAATTCTTAAACAGCTGCACTTCTGGACTGATTCAAAACCCGGCCGCCGG
JMSF010D08+ AATTCTTATTTAATTCTTAAACAGCTGCACTTCTGGACTGATTCAAAACCCGGCCGCCGG
                      ____________________________________________________________
consensus AATTCTTATTTAATTCTTAAACAGCTGCACTTCTGGACTGATTCAAAACCCGGCCGCCGG
 
. : . : . : . : . : . :
JMSF051A13+ CAAGGGTCCATGAGAGAGAGAGAAACGAATTTAGAGAGAGAGAGAGAGAGAATCTCGCTC
JMSF045D13+ CAAGGGTCCATGAGAGAGAGAGAAACGAATTTAGAGAGAGAGAGAGAGAGAATCTCGCTC
JMSF010D08+ CAAGGGTCCATGAGAGAGAGAGAAACGAATTTAGAGAGAGAGAGAGAGAGAATCTCGCTC
                      ____________________________________________________________
consensus CAAGGGTCCATGAGAGAGAGAGAAACGAATTTAGAGAGAGAGAGAGAGAGAATCTCGCTC
 
. : . : . : . : . : . :
JMSF051A13+ TGCTCTCCGAAAGAGATAGAAG
JMSF045D13+ TGCTCTCCGAAAGAGATAGAAG
JMSF010D08+ TGCTCTCCGAAAGAGATAGAAGGCGGAGCAGAGTGTGGGAGAGACTTTGTTTTGTAGATC
                      ____________________________________________________________
consensus TGCTCTCCGAAAGAGATAGAAGGCGGAGCAGAGTGTGGGAGAGACTTTGTTTTGTAGATC