Previous Contig 005133:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS157H11Sequence567005133 (6)
JMSF002D10Sequence336005133 (6)715013003 (4)
JMSF005G18Sequence397005133 (6)
JMSF010C13Sequence295005133 (6)727013003 (4)
JMSF035O15Sequence597005133 (6)771013003 (4)
JMSF046M01Sequence420005133 (6)626013003 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS157H11+ TTCAGTTTAACAGGAAACTGAAACATGATCCGATTAAAGAGATCCGCGCAA
JMSF035O15+ TTTCCGGTTCAGTTTAACAGGAAACTGAAACATGATCCGATTAAAGAGATCCGCGCAA
                      ____________________________________________________________
consensus TTTCCGGTTCAGTTTAACAGGAAACTGAAACATGATCCGATTAAAGAGATCCGCGCAA
 
. : . : . : . : . : . :
JMFS157H11+ CACAAGTCCACACAGTGTACTTTGATCATACCTTTCTCGTTTAGGGTTTAGGGTTTAGTT
JMSF035O15+ CACAAGTCCACACAGTGTACTTTGATCATACCTTTCTCGTTTAGGGTTTAGGGTTTAGTT
                      ____________________________________________________________
consensus CACAAGTCCACACAGTGTACTTTGATCATACCTTTCTCGTTTAGGGTTTAGGGTTTAGTT
 
. : . : . : . : . : . :
JMFS157H11+ GTCAACAAAAACGAGGCTCAGATCTGTGAAATAGGGCGGAGGAGAAGCCGCACCGCCATG
JMSF035O15+ GTCAACAAAAACGAGGCTCAGATCTGTGAAATAGGGCGGAGGAGAAGCCGCACCGCCATG
                      ____________________________________________________________
consensus GTCAACAAAAACGAGGCTCAGATCTGTGAAATAGGGCGGAGGAGAAGCCGCACCGCCATG
 
. : . : . : . : . : . :
JMFS157H11+ GCTGCAGACCTACCGGTCGCCCCGCCAAGATACGGGGCGGATCATTCCCCCACCCGGTGA
JMSF005G18+ CCCGCCAAGATACGGGGCGGATCATTCCCCCACCCGGTGA
JMSF046M01+ GCTGCAGACNTATCGGTCGCCCCGCCAAGATACGGGGCGGATCNTTCCCCCACCCGGTGA
JMSF035O15+ GCTGCAGACCTACCGGTCGCCCCGCCAAGATACGGGGCGGATCATTCCCCCACCCGGTGA
                      ____________________________________________________________
consensus GCTGCAGACCTACCGGTCGCCCCGCCAAGATACGGGGCGGATCATTCCCCCACCCGGTGA
 
. : . : . : . : . : . :
JMFS157H11+ ACTGAACAAAAATCCGTTTATCATCACAGCCTACACAAACATCATCACCATCAACATCAA
JMSF002D10+ CATCACAGCCTACACAAACATCATCACCATCAACATCAA
JMSF005G18+ ACTGAACAAAAATCCGTTTATCATCACAGCCTACACAAACATCATCACCATCAACATCAA
JMSF046M01+ NCTGAACAAAAATCCGTTTATCATCACAGCCTACACAAACATCATCACCATCAACATCAA
JMSF035O15+ ACTGAACAAAAATCCGTTTATCATCACAGCCTACACAAACATCATCACCATCAACATCAA
                      ____________________________________________________________
consensus ACTGAACAAAAATCCGTTTATCATCACAGCCTACACAAACATCATCACCATCAACATCAA
 
. : . : . : . : . : . :
JMFS157H11+ CAACAATAACAACAGAACAATAATTATATGAAGCAGCATATACAGAACTATAGAGTTAAT
JMSF002D10+ CAACAATAACAACAGAACAATAATTATATGAAGCAGCATATACAGAACTATAGAGTTAAT
JMSF005G18+ CAACAATAACAACAGAACAATAATTATATGAAGCAGCATATACAGAACTATAGAGTTAAT
JMSF046M01+ CAACAATAACAACAGAACAATAATTATATGAAGCAGCATATACAGAACTATAGAGTTAAT
JMSF035O15+ CAACAATAACAACAGAACAATAATTATATGAAGCAGCATATACAGAACTATAGAGTTAAT
JMSF010C13+ AATAACAACAGANCAATAATTATATGAAGCAGCATATACAGAACTATAGAGTTAAT
                      ____________________________________________________________
consensus CAACAATAACAACAGAACAATAATTATATGAAGCAGCATATACAGAACTATAGAGTTAAT
 
. : . : . : . : . : . :
JMFS157H11+ TCCACTTCAGATCCCAGAGGTTGAAGTTCACAAGAACGTTTTTTCTTGGCATGAAAATGA
JMSF002D10+ TCCACTTCAGATCCCAGAGGTTGAAGTTCACAAGAACGTTTTTTCTTGGCATGAAAATGA
JMSF005G18+ TCCACTTCAGATCCCAGAGGTTGAAGTTCACAAGAACGTTTTTTCTTGGCATGAAAATGA
JMSF046M01+ TCCACTTCAGATCCCAGAGGTTGAAGTTCACAAGAACGTTTTTTCNTGGCATGAAANTGA
JMSF035O15+ TCCACTTCAGATCCCAGAGGTTGAAGTTCACAAGAACGTTTTTTCTTGGCATGAAAATGA
JMSF010C13+ TCCACTTCAGATCCCAGAGGTTGAAGTTCACAAGAACGTTTTTTCTTGGCATGAAAATGA
                      ____________________________________________________________
consensus TCCACTTCAGATCCCAGAGGTTGAAGTTCACAAGAACGTTTTTTCTTGGCATGAAAATGA
 
. : . : . : . : . : . :
JMFS157H11+ TAAATCAAGAAGCAGAGATGAAGAAGAAGAAGAAGAAGATGAAATGGTTTCATTGTTTCA
JMSF002D10+ TAAATCAAGAAGCAGAGATGAAGAAGAAGAAGAAGAAGATGAAATGGTTTCATTGTTTCA
JMSF005G18+ TAAATCAAGAAGCAGAGATGAAGAAGAAGAAGAAGAAGATGAAATGGTTTCATTGTTTCA
JMSF046M01+ TAAATCAAGAAGCAGAGATGAAGAAGAAGAAGAAGAAGANGAAATGGTTTCATTGTTTCA
JMSF035O15+ TAAATCAAGAAGCAGAGATGAAGAAGAAGAAGAAGAAGATGAAATGGTTTCATTGTTTCA
JMSF010C13+ TAAATCAAGAAGCAGAGATGAAGAAGAAGAAGAAGAAGATGAAATGGTTTCATTGTTTCA
                      ____________________________________________________________
consensus TAAATCAAGAAGCAGAGATGAAGAAGAAGAAGAAGAAGATGAAATGGTTTCATTGTTTCA
 
. : . : . : . : . : . :
JMFS157H11+ CAGCCAAGAAGGGTTGTTGAGTTTTGGAATTAGAAATCATCGGCATGGGAAGACGGTCAA
JMSF002D10+ CAGCCAAGAAGGGTTGTTGAGTTTTGGAATTAGAAATCATCGGCATGGGAAGACGGTCAA
JMSF005G18+ CAGCCAAGAAGGGTTGTTGAGTTTTGGAATTAGAAATCATCGGCATGGGAAGACGGTCAA
JMSF046M01+ CAGCCAAGAAGGGTTGTTGAGTTTTGGAATTAGAAATCATCGGCATGGGAAGACGGTCAA
JMSF035O15+ CAGCCAAGAAGGGTTGTTGAGTTTTGGAATTAGAAATCATCGGCATGGGAAGACGGTCAA
JMSF010C13+ CAGCCAAGAAGGGTTGTTGAGTTTTGGAATTAGAAATCATCGGCATGGGAAGACGGTCAA
                      ____________________________________________________________
consensus CAGCCAAGAAGGGTTGTTGAGTTTTGGAATTAGAAATCATCGGCATGGGAAGACGGTCAA
 
. : . : . : . : . : . :
JMFS157H11+ CCACCCTGGAAATCCCCATCGCTCTCCCCACC-CTCA
JMSF002D10+ CCACCCTGGAAATCCCCATCGCTCTCCCCACC-CTCATTCTCTATGCACCTCAG
JMSF005G18+ CCACCCTGGAAATCCCCATCGCTCTCCCCACC-CTCATTCTCTATGCACCTCAGTTC
JMSF046M01+ CCACCCTGGAAATCCCCATCGCTCTCCCCACCGCTCATTCTCTATGCACCTCAGTTC
JMSF035O15+ CCACCCTGGAAATCCCCATCGCTCTCCCCACC-CTCATTCTCTATGCACCTCAGTTC
JMSF010C13+ CCACCCTGGAAATCCCCATCGCTCTCCCCACC-CTCATTCTCTATGCACCTCAGTTCACC
                      ____________________________________________________________
consensus CCACCCTGGAAATCCCCATCGCTCTCCCCACC-CTCATTCTCTATGCACCTCAGTTCACC