Previous Contig 005132:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010C08Sequence271005132 (4)738022359gb:AF322255_17861070.015Arabidopsis thaliana magnesium transporter protein (GMN10) mRNA, complete cds.
JMSF025H14Sequence614005132 (4)gb:AB005243_15095306e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.761005132 (4)gb:AF322255_17861075e-55Arabidopsis thaliana magnesium transporter protein (GMN10) mRNA, complete cds.
JMSF032I10Sequence695005132 (4)gb:AB005243_15095309e-36Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRN17.712023531gb:AC087851_17341924e-16Oryza sativa chromosome 3 BAC OSJNBb0072E24 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025H14- TGAGCACAGGCTTTAAGAAAAACATCATTGAGGCAAGGGATTG
                      ____________________________________________________________
consensus TGAGCACAGGCTTTAAGAAAAACATCATTGAGGCAAGGGATTG
 
. : . : . : . : . : . :
rJMSF025H14- GTGAAAAGAAAGATAAACATATGCTCACTATGTTCCTTACTCACACGAGGTTCTAGATCC
                      ____________________________________________________________
consensus GTGAAAAGAAAGATAAACATATGCTCACTATGTTCCTTACTCACACGAGGTTCTAGATCC
 
. : . : . : . : . : . :
rJMSF025H14- CATAATCTCTGCTCCAGTCGTTGAATCCGTGAATGCAAGGCTGCTTCAACCACCTCAAGC
                      ____________________________________________________________
consensus CATAATCTCTGCTCCAGTCGTTGAATCCGTGAATGCAAGGCTGCTTCAACCACCTCAAGC
 
. : . : . : . : . : . :
rJMSF025H14- AAAAATGGCATTGAATGCCCTCCACTCAAGTTGTCAGGGTTTAGCCGAGGTAAGGGTGCA
                      ____________________________________________________________
consensus AAAAATGGCATTGAATGCCCTCCACTCAAGTTGTCAGGGTTTAGCCGAGGTAAGGGTGCA
 
. : . : . : . : . : . :
rJMSF025H14- CCAATGAAAGCTGTTCCTCCTTTACTGTTATAGTTGAATACAAGGACACTTTCCTGCATT
JMSF032I10+ CTTTACTGTTATAGTTGAATACAAGGACACTTTCCTGCATT
                      ____________________________________________________________
consensus CCAATGAAAGCTGTTCCTCCTTTACTGTTATAGTTGAATACAAGGACACTTTCCTGCATT
 
. : . : . : . : . : . :
rJMSF025H14- ATTATGGCTCGTAAAGAGCCCAGATTCAATAGGATTGCATGTTCACGGACCAGTAAAGAA
JMSF032I10+ ATTATGGCTCGTAAAGAGCCCAGATTCAATAGGATTGCATGTTCACGGACCAGTAAAGAA
                      ____________________________________________________________
consensus ATTATGGCTCGTAAAGAGCCCAGATTCAATAGGATTGCATGTTCACGGACCAGTAAAGAA
 
. : . : . : . : . : . :
rJMSF025H14- GGCATTGAATTTGTCAACCACAATGACGGATCAACACTCCGGATATCTCGAGGACGAAGA
JMSF032I10+ GGCATTGAATTTGTCAACCACAATGACGGATCAACACTCCGGATATCTCGAGGACGAAGA
                      ____________________________________________________________
consensus GGCATTGAATTTGTCAACCACAATGACGGATCAACACTCCGGATATCTCGAGGACGAAGA
 
. : . : . : . : . : . :
rJMSF025H14- CCGCTCGACTTCAGCAAGTTTCTTCTATTTATTTTTCTTGTTGAGACCGTCCTATTTGAC
JMSF032I10+ CCGCTCGACTTCAGCAAGTTTCTTCTATTTATTTTTCTTGTTGAGACCGTCCTATTTGAC
JMSF025H14+ TTCAGCAAGTTTNTTNTATTTATTTTTNTNGTTGAGACCGTCNTATTTGAC
                      ____________________________________________________________
consensus CCGCTCGACTTCAGCAAGTTTCTTCTATTTATTTTTCTTGTTGAGACCGTCCTATTTGAC
 
. : . : . : . : . : . :
rJMSF025H14- TTTACTTCCAGTACCTCGTAAACCGGTTCGCGGATCCCAAGGGACAGAGAATCGCCGGCG
JMSF032I10+ TTTACTTCCAGTACCTCGTAAACCGGTTCGCGGATCCCAAGGGACAGAGAATCGCCGGCG
JMSF025H14+ TTTANTTCCAGTACCTNGTAAACCGGTTCGCGGATCCCAAGGGACAGAGAATCGCCGGCG
                      ____________________________________________________________
consensus TTTACTTCCAGTACCTCGTAAACCGGTTCGCGGATCCCAAGGGACAGAGAATCGCCGGCG
 
. : . : . : . : . : . :
rJMSF025H14- ACAACCTTCCGCTGACCGACCGAAGCACTGGAAAACTCCTTCTGAGCCGCCGCTTCAGCC
JMSF032I10+ ACAACCTTCCGCTGACCGACCGAAGCACTGGAAAACTCCTTCTGAGCCGCCGCTTCAGCC
JMSF025H14+ ACAACCTTCCGCTGACCGACCGAAGCACTGGAAAACTCCTTNTGAGCCGCCGCTTCAGCC
                      ____________________________________________________________
consensus ACAACCTTCCGCTGACCGACCGAAGCACTGGAAAACTCCTTCTGAGCCGCCGCTTCAGCC
 
. : . : . : . : . : . :
rJMSF025H14- AATTCCTCTTGCGGATCAACCTTACTATCATCCCCGCTAATCTCCCGATCAACCAAAACC
JMSF032I10+ AATTCCTCTTGCGGATCAACCTTACTATCATCCCCGCTAATCTCCCGATCAACCAAAACC
JMSF025H14+ AATTCCTCTTGCGGATCAACCTTACTATCATCCCCGCTAATCTCCCGATCAACCAAAACC
                      ____________________________________________________________
consensus AATTCCTCTTGCGGATCAACCTTACTATCATCCCCGCTAATCTCCCGATCAACCAAAACC
 
. : . : . : . : . : . :
rJMSF025H14- TCCTGCTCGGGCTCCACCCTCGACTTCGTCAAGCACCTGACAACATCCAGGGTCCGCACC
JMSF032I10+ TCCTGCTCGGGCTCCACCCTCGACTTCGTCAAGCACCTGACAACATCCAGGGTCCGCACC
JMSF025H14+ TCCTGCTCGGGCTCCACCCTCGACTTCGTCAAGCACCTGACAACATCCAGGGTCCGCACC
                      ____________________________________________________________
consensus TCCTGCTCGGGCTCCACCCTCGACTTCGTCAAGCACCTGACAACATCCAGGGTCCGCACC
 
. : . : . : . : . : . :
rJMSF025H14- TTCACCGAGACTCTGCGGCCCCTATGCAACGACGGCAAGCCCGAGATTCTGAACGGG
JMSF032I10+ TTCACCGAGACTCTGCGGCCCCTATGCAACGACGGCAAGCCCGAGATTCTGAACGGGCGA
JMSF025H14+ TTCACCGAGACTCTGCGGCCCCTATGCAACGACGGCAAGCCCGAGATTCTGAACGGGAGA
                      ____________________________________________________________
consensus TTCACCGAGACTCTGCGGCCCCTATGCAACGACGGCAAGCCCGAGATTCTGAACGGGCGA
 
. : . : . : . : . : . :
JMSF032I10+ AGGACGGGGCATTCGCCGGACAAAACAATCCGGAGCTGCGGCGATCGGACAGGCAATTGG
JMSF025H14+ AGGACGGGGCATTCGCCGGACAAAACAATCCGGAGCTGCGGCGATCGGACAGGCAATTGG
JMSF010C08+ CCGGAGCTGCGGCGATCGGACAGGCAATTGG
                      ____________________________________________________________
consensus AGGACGGGGCATTCGCCGGACAAAACAATCCGGAGCTGCGGCGATCGGACAGGCAATTGG
 
. : . : . : . : . : . :
JMSF032I10+ AGGAGATACGGAGCTTGAAATGCGGCGGCCATTGTCGGAGGACATGTGAGAGAAGTGAAA
JMSF025H14+ AGGAGATACGGAGCTTGAAATGCGGCGGCCATTGTCGGAGGACATGTGAGAGAAGTGAAA
JMSF010C08+ AGGAGATACGGAGCTTGAAATGCGGCGGCCATTGTCGGAGGACATGTGAGAGAAGTGAAA
                      ____________________________________________________________
consensus AGGAGATACGGAGCTTGAAATGCGGCGGCCATTGTCGGAGGACATGTGAGAGAAGTGAAA
 
. : . : . : . : . : . :
JMSF032I10+ TTTTGATAAATAGTAATATGCAGAAATGCAGAATCAAGTCTGAGATAGCCAAT
JMSF025H14+ TTTTGATAAATAGTAATATGCAGAAATGCAGAATCAAGTCTGAGATAGCCAAT
JMSF010C08+ TTTTGATAAATAGTAATATGCAGAAATGCAGAATCAAGTCTGAGATAGCCAATGGAGAAA
                      ____________________________________________________________
consensus TTTTGATAAATAGTAATATGCAGAAATGCAGAATCAAGTCTGAGATAGCCAATGGAGAAA
 
. : . : . : . : . : . :
JMSF010C08+ TGAAATTATTGGCGAGTATTTATAGGTTAGAGGTTGTGAGGTGAAGTAGGCGATGAAGCT
                      ____________________________________________________________
consensus TGAAATTATTGGCGAGTATTTATAGGTTAGAGGTTGTGAGGTGAAGTAGGCGATGAAGCT
 
. : . : . : . : . : . :
JMSF010C08+ GGTGGTTGTGGATGCTTTGGCGAAGAAACGGGAGATAGTTTAGCTTCTGGATTTCTGGTC
                      ____________________________________________________________
consensus GGTGGTTGTGGATGCTTTGGCGAAGAAACGGGAGATAGTTTAGCTTCTGGATTTCTGGTC