Previous Contig 005131:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D11Sequence537005131 (17)gb:AB009888_15108171e-37Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.731005131 (17)gb:AB009888_15108178e-52Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMFF003A16Sequence382005131 (17)gb:AB009888_15108175e-17Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.127005131 (17)
JMFF028H10Sequence529005131 (17)gb:AB009888_15108175e-37Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.752005131 (17)gb:AB009888_15108174e-51Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMFN015M03Sequence501005131 (17)gb:AB009888_15108173e-32Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMFS040F05Sequence624005131 (17)gb:AB009888_15108173e-52Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMFS079C02Sequence641005131 (17)gb:AB009888_15108172e-52Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMSF010B21Sequence319005131 (17)gb:AB009888_15108179e-15Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.761005131 (17)gb:AB009888_15108172e-53Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMSF024N05Sequence687005131 (17)gb:AB009888_15108172e-44Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.690005131 (17)gb:AB009888_15108175e-45Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMSF033N24Sequence593005131 (17)gb:AB009888_15108172e-44Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.652005131 (17)gb:AB009888_15108172e-52Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.
JMSF035N12Sequence592005131 (17)gb:AB009888_15108171e-42Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.658013872 (4)gb:AP004884_18465932e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P051
JMSF043H04Sequence752005131 (17)gb:AB009888_15108172e-53Nicotiana tabacum mRNA for DC1.2 homologue, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF002D11- CCCGATCTTATTTAGTTATTTACAATAGAAA
rJMFF028H10- AACTCGGTGACACCCGATCTTATTTAGTTATTTACAATAGAAA
rJMSF010B21- AA
                      ____________________________________________________________
consensus AACTCGGTGACACCCGATCTTATTTAGTTATTTACAATAGAAA
 
. : . : . : . : . : . :
rJMFF003A16- AAATTCTTAGGTAACATATCTATGGTACTACATCAC
rJMFF002D11- CATTGTTTGTCTAGTAGTAAAGTAAAATTCATAGGTAACATATCTATGGTACTACATCAC
rJMFF028H10- CATTGTTTGTCTAGTAGTAAAGTAAAATTCATAGGTAACATATCTATGGTACTACATCAC
rJMSF024N05- TACTACATCAC
rJMSF033N24- C
rJMSF010B21- CATTGTTTGTCTAGTAGTAAAGTAAAATTCATAGGTAACATATCTATGGTACTACATCAC
                      ____________________________________________________________
consensus CATTGTTTGTCTAGTAGTAAAGTAAAATTCATAGGTAACATATCTATGGTACTACATCAC
 
. : . : . : . : . : . :
rJMFF003A16- AAAAGCCCACTACACACCCATCANAATTATAGCACATGTACATACAACCTTTTTCCATCA
rJMFF002D11- AAAAGCCCACTACACACCCATCAAAATTATA-CACA--GACATACAACCTTTTTCCATCA
rJMFF028H10- AAAAGCCCACTACACACCCATCAAAATTATA-CACA--GACATACAACCTTTTTCCATCA
rJMSF024N05- AAAAGCCCACTACACACCCATCAAAATTATA-CACA--GACATACAACCTTTTTCCATCA
rJMSF033N24- AAAAGCCCACTACACACCCATCAAAATTATA-CACA--GACATACAACCTTTTTCCATCA
rJMSF010B21- AAAAGCCCACTACACACCCATCAAAATTATA-CACA--GACATACAACCTTTTTCCATCA
JMSF043H04+ CCATCAAAATTATA-CACA--GACATACAACCTTTTTCCATCA
                      ____________________________________________________________
consensus AAAAGCCCACTACACACCCATCAAAATTATA-CACA--GACATACAACCTTTTTCCATCA
 
. : . : . : . : . : . :
rJMFF003A16- CTCNAACATGCANCATGTTTCTTGGAGA
rJMFF002D11- CTCAAACATGCAACATGTTTCTTGGAGAAATTAACAATGTACGATTAAGCTTAATTAGTT
rJMFF028H10- CTCAAACATGCAACATGTCTCTTGGAGAAATTAACAATGTACGATTAAGCTTAATTAGTT
rJMSF024N05- CTCAAACATGCAACATGTTTCTTGGAGAAATTAACAATGTACGATTAAGCTTAATTAGTT
rJMSF033N24- CTCAAACATGCAACATGTTTCTTGGAGAAATTAACAATGTACGATTAAGCTTAATTAGTT
rJMSF010B21- CTCAAACATGCAACATGTTTCTTGGAGAAATTAACAATGTACGATTAAGCTTAATTAGTT
JMFS079C02+ ATTAAGCTTAATTAGTT
JMSF043H04+ CTCAAACATGCAACATGTTTCTTGGAGAAATTAACAATGTACGATTAAGCTTAATTAGTT
JMSF024N05+ AATTAACAATGTACGATTAAGCTTAATTAGTT
                      ____________________________________________________________
consensus CTCAAACATGCAACATGTTTCTTGGAGAAATTAACAATGTACGATTAAGCTTAATTAGTT
 
. : . : . : . : . : . :
rJMFF002D11- ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
rJMFF028H10- ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
rJMSF024N05- ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
rJMSF033N24- ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
rJMSF010B21- ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
JMFS079C02+ ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTGNCTAGTCAAGTGCGCAACCTT
JMFS040F05+ GCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
JMSF043H04+ ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
JMSF024N05+ ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
                      ____________________________________________________________
consensus ATGGAGAGCGGCGAAGCTGTTGATTAGAGCTAAAGCGTTGCTAGTCAAGTGCGCAACCTT
 
. : . : . : . : . : . :
rJMFF002D11- CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
rJMFF028H10- CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
rJMSF024N05- CCGAATCTGCG--CGCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
rJMSF033N24- CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
rJMSF010B21- CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
JMFS079C02+ CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
JMFS040F05+ CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
JMSF043H04+ CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
JMSF024N05+ CCGAATCTGCG--CGCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
JMSF035N12+ TGCGCCCTCACGGCGGTCTTAAGTTAGCCGTCGACGGATTTTCCGGCGAACCC
JMFF002D11+ C
JMSF033N24+ CTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
                      ____________________________________________________________
consensus CCGAATCTGCGCCCTCACGGCGGTCTTAAGTTTGCCGTCGACGGATTTTCCGGCGAACCC
 
. : . : . : . : . : . :
rJMFF002D11- TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
rJMFF028H10- TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
rJMSF024N05- TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
rJMSF033N24- TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
rJMSF010B21- TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
JMFS079C02+ TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
JMFS040F05+ TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
JMSF043H04+ TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
JMSF024N05+ TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
JMSF035N12+ TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCANTAACCCACGTCTCTATGTCGCTCAT
JMFF028H10+ CGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
JMFN015M03+ TATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTTTATGTCGCTCAT
JMFF002D11+ TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
JMSF033N24+ TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
                      ____________________________________________________________
consensus TTCGGTGCAGGTATCGTCGTCCGTCAGGGCGGCACTAACCCACGTCTCTATGTCGCTCAT
 
. : . : . : . : . : . :
rJMFF002D11- TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
rJMFF028H10- TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
rJMSF024N05- TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
rJMSF033N24- TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
rJMSF010B21- TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMFS079C02+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMFS040F05+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMSF043H04+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMSF024N05+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMSF035N12+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMFF028H10+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMFN015M03+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTATGATGCG
JMFF002D11+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
JMSF033N24+ TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
                      ____________________________________________________________
consensus TTTCATGTCGAAATCCGGGCCGGAGAGCTCCTTCATTTCCTCCATTGAGCGTCTGATGCG
 
. : . : . : . : . : . :
rJMFF002D11- GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
rJMFF028H10- GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
rJMSF024N05- GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
rJMSF033N24- GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
rJMSF010B21- GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMFS079C02+ GTCCACGGAGTCGCGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMFS040F05+ GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMSF043H04+ GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMSF024N05+ GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMSF035N12+ GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMFF028H10+ GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMFN015M03+ GTCCACGGAGTTGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMFF003A16+ CTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMFF002D11+ GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
JMSF033N24+ GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
                      ____________________________________________________________
consensus GTCCACGGAGTCGTGTAGCTCCTCGATGCAGTCGCGCATAGCGCCGACCTCCCGCCGCGT
 
. : . : . : . : . : . :
rJMFF002D11- CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
rJMFF028H10- CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
rJMSF024N05- CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
rJMSF033N24- CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
rJMSF010B21- CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMFS079C02+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMFS040F05+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMSF043H04+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMSF024N05+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMSF035N12+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMFF028H10+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMFN015M03+ CAGATTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMFF003A16+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMFF002D11+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMSF033N24+ CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
JMSF010B21+ AAGTCGACTTGGTGGTCTG
                      ____________________________________________________________
consensus CAGGTTGTAGGTCTCCGCCGCCAGTTTCGCCAGCTTGGCGGAAGTCGACTTGGTGGTCTG
 
. : . : . : . : . : . :
rJMFF002D11- CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
rJMFF028H10- CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
rJMSF024N05- CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
rJMSF033N24- CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
rJMSF010B21- CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMFS079C02+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMFS040F05+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMSF043H04+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMSF024N05+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMSF035N12+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMFF028H10+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMFN015M03+ CAGCGTCACCGTCTGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMFF003A16+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMFF002D11+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMSF033N24+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
JMSF010B21+ CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
                      ____________________________________________________________
consensus CAGCGTCACCGTCAGCGCCGTCTTGGCGAGAAGCTCCGGGTCGGCTCCGATCTCACTTGC
 
. : . : . : . : . : . :
rJMFF002D11- ATGGCTCGACAGAGATCTGTAACACAGATTANGGTACGTCGTTGCCTGGCAAGATGTTTT
rJMFF028H10- ATGGCTCGACAGAGATCTGTAACACAGATTANGGTACGTCGTTGCCTGGCAAGATGTTTT
rJMSF024N05- ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
rJMSF033N24- ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
rJMSF010B21- ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMFS079C02+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMFS040F05+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMSF043H04+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMSF024N05+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMSF035N12+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMFF028H10+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMFN015M03+ ATGGCTCGTCAGAGATCTGTAACACAGATTTGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMFF003A16+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMFF002D11+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMSF033N24+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
JMSF010B21+ ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
                      ____________________________________________________________
consensus ATGGCTCGACAGAGATCTGTAACACAGATTAGGGTACGTCGTTGCCTGGCAAGATGTTTT
 
. : . : . : . : . : . :
rJMFF002D11- AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGC
rJMFF028H10- AATGAACTCGGTGTTTGTCGTTNCGANAGCCACCGCCCGCGCCGNCGCCGGA
rJMSF024N05- AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
rJMSF033N24- AATGAACTCGGTGTTTGTCGTTCCGANAGCCACCGCCCGCGCCGCCGC
rJMSF010B21- AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMFS079C02+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMFS040F05+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMSF043H04+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMSF024N05+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMSF035N12+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMFF028H10+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMFN015M03+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMFF003A16+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMFF002D11+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMSF033N24+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
JMSF010B21+ AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
                      ____________________________________________________________
consensus AATGAACTCGGTGTTTGTCGTTCCGACAGCCACCGCCCGCGCCGCCGCCGGATTTACAGA
 
. : . : . : . : . : . :
rJMSF024N05- GAATAATGCTAACGCAAGTACTGA
rJMSF010B21- GAATAATGCTAACGCAAGTACTGAAGCANGAAAAGCTACAAG
JMFS079C02+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMFS040F05+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMSF043H04+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMSF024N05+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMSF035N12+ GAATAATGCTAACGCAAGTANTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMFF028H10+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMFN015M03+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCGAACC
JMFF003A16+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMFF002D11+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMSF033N24+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
JMSF010B21+ GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
                      ____________________________________________________________
consensus GAATAATGCTAACGCAAGTACTGAAGCAAGAAAAGCTACAAGAAATTGGTTATTCAAACC
 
. : . : . : . : . : . :
JMFS079C02+ CATTTTCATCTCTCTTTCTCTCTC
JMFS040F05+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCT
JMSF043H04+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTTAATCACTT
JMSF024N05+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTTAATCACTTAGG
JMSF035N12+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTNTTAATCACTTAGGC
JMFF028H10+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTTAATCACTT
JMFN015M03+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTT
JMFF003A16+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTT
JMFF002D11+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTTAATCACTTAGGC
JMSF033N24+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTTAATCACTTAGGC
JMSF010B21+ CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTTAATCACTTAGGCTATCC
                      ____________________________________________________________
consensus CATTTTCATCTCTCTTTCTCTCTCTGGTTCTTGAAGACTTCTTAATCACTTAGGCTATCC