Previous Contig 005130:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010B20Sequence263005130 (3)gb:AP006067_18608412e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P056746011547 (2)gb:AY062550_15652062e-31Arabidopsis thaliana putative protein (At4g36050; T19K4.180) mRNA, complete cds.
JMSF012H01Sequence263005130 (3)pir|T05497|T054971e-24hypothetical protein T19K4.180 - Arabidopsis thaliana>gb:ATCHRIV84_1547565 Arabi786011547 (2)gb:AY062550_15652064e-36Arabidopsis thaliana putative protein (At4g36050; T19K4.180) mRNA, complete cds.
JMSF040F22Sequence656005130 (3)pir|T05497|T054973e-71hypothetical protein T19K4.180 - Arabidopsis thaliana>gb:ATCHRIV84_1547565 Arabi577011102 (3)gb:AC011810_15375113e-63Arabidopsis thaliana chromosome I BAC T6J4 genomic sequence, complete sequence.>

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040F22+ TTTCTAAACTCATTCTTCTCAAAATCGGGTCCTGCA
                      ____________________________________________________________
consensus TTTCTAAACTCATTCTTCTCAAAATCGGGTCCTGCA
 
. : . : . : . : . : . :
JMSF040F22+ TCACAACGATCAATAGAAGCAGGAGCAATATTAAGATCCCCAACAACAACTATCCTCCGT
                      ____________________________________________________________
consensus TCACAACGATCAATAGAAGCAGGAGCAATATTAAGATCCCCAACAACAACTATCCTCCGT
 
. : . : . : . : . : . :
JMSF040F22+ CCTTGACGTAGTAGACAATCCCACCTTCTCTCTAATATCTTGAAAAATATAAGCTTAAAT
                      ____________________________________________________________
consensus CCTTGACGTAGTAGACAATCCCACCTTCTCTCTAATATCTTGAAAAATATAAGCTTAAAT
 
. : . : . : . : . : . :
JMSF040F22+ TGGATTCTTTCGGAATCATCAGAACCAGCCCTGGGACCATATATATTGAAAAGAACAAAA
                      ____________________________________________________________
consensus TGGATTCTTTCGGAATCATCAGAACCAGCCCTGGGACCATATATATTGAAAAGAACAAAA
 
. : . : . : . : . : . :
JMSF040F22+ TGCCCATGATCTGTGATTATACAACGCCCCTCACTATCGACTTTAAGAAGTTCATCCCTA
                      ____________________________________________________________
consensus TGCCCATGATCTGTGATTATACAACGCCCCTCACTATCGACTTTAAGAAGTTCATCCCTA
 
. : . : . : . : . : . :
JMSF040F22+ GAAAATCCCTCAAGGCCTTGTGCAATCAGAGAACTGTTATCTTTTCTAGATCCACATCCC
                      ____________________________________________________________
consensus GAAAATCCCTCAAGGCCTTGTGCAATCAGAGAACTGTTATCTTTTCTAGATCCACATCCC
 
. : . : . : . : . : . :
JMSF012H01+ GGAGCGGCCCTTA
JMSF040F22+ TGAGAAGCCTTAAGAAGTCCTGTAAATCCCTCCTCGGAATAGCCAGCGGAGCGGCCCTTA
                      ____________________________________________________________
consensus TGAGAAGCCTTAAGAAGTCCTGTAAATCCCTCCTCGGAATAGCCAGCGGAGCGGCCCTTA
 
. : . : . : . : . : . :
JMSF012H01+ TCGGAAGTGCGAGTGCAAGAGAAGAAGGACTCGTAGCCTTCAGCCCTAACCAAGTCGGCT
JMSF040F22+ TCGGAAGTGCGAGTGCAAGAGAAGAAGGACTCGTAGCCTTCAGCCCTAACCAAGTCGGCT
JMSF010B20+ CTTCAGCCCTAACCAAGTCGGCT
                      ____________________________________________________________
consensus TCGGAAGTGCGAGTGCAAGAGAAGAAGGACTCGTAGCCTTCAGCCCTAACCAAGTCGGCT
 
. : . : . : . : . : . :
JMSF012H01+ CGCAGGTCTTGTCTCGATAGTTTCGTCTCCTGGAAGCAGATGATATCAGCGTCGAGCGAA
JMSF040F22+ CGCAGGTCTTGTCTCGATAGTTTCGTCTCCTGGAAGCAGATGATATCAGCGTCGAGCGAA
JMSF010B20+ CGCAGGTCTTGTCTCGATAGTTTCGTCTCCTGGAAGCAGATGATATCAGCGTCGAGCGAA
                      ____________________________________________________________
consensus CGCAGGTCTTGTCTCGATAGTTTCGTCTCCTGGAAGCAGATGATATCAGCGTCGAGCGAA
 
. : . : . : . : . : . :
JMSF012H01+ TCGAGAAGGCCGGGAAGAGAACCGAACTGTGAGACTCGAGGCCTTAGGCCGTTCACGTTG
JMSF040F22+ TCGAGAAGGCCGGGAAGAGAACCGAACTGTGAGACTCGAGGCCTTAGGCCGTTCACGTTG
JMSF010B20+ TCGAGAAGGCCGGGAAGAGAACCGAACTGTGAGACTCGAGGCCTTAGGCCGTTCACGTTG
                      ____________________________________________________________
consensus TCGAGAAGGCCGGGAAGAGAACCGAACTGTGAGACTCGAGGCCTTAGGCCGTTCACGTTG
 
. : . : . : . : . : . :
JMSF012H01+ TACGTCACTATCTTCATTCATTCATTCATTCGGAGTTCCAGCAGCAACGCAGTGCTGAGT
JMSF040F22+ TACGTCACTATCTTCATTCATTCATTCATTCGGAGTTCCAGCAGCAACGCAGTGCTGAGT
JMSF010B20+ TACGTCACTATCTTCATTCATTCATTCATTCGGAGTTCCAGCAGCAACGCAGTGCTGAGT
                      ____________________________________________________________
consensus TACGTCACTATCTTCATTCATTCATTCATTCGGAGTTCCAGCAGCAACGCAGTGCTGAGT
 
. : . : . : . : . : . :
JMSF012H01+ CCACTCGCT
JMSF040F22+ CCACTCGCTAACTCGTTT
JMSF010B20+ CCACTCGCTAACTCGTTTCGTTTTTGCCACTGCGCTCAAATCCTTCCTTCACTTTTTCCC
                      ____________________________________________________________
consensus CCACTCGCTAACTCGTTTCGTTTTTGCCACTGCGCTCAAATCCTTCCTTCACTTTTTCCC