Previous Contig 005129:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008F06Sequence401005129 (4)pir|H84587|H845872e-09probable WD-40 repeat protein [imported] - Arabidopsis thaliana>gb:AC006569_1534783011545 (3)gb:AE016959_10229901e-73Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMFF009A02Sequence396005129 (4)pir|H84587|H845876e-09probable WD-40 repeat protein [imported] - Arabidopsis thaliana>gb:AC006569_1534669011545 (3)gb:AE016959_10229903e-54Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02
JMFS056C06Sequence614005129 (4)pir|H84587|H845872e-08probable WD-40 repeat protein [imported] - Arabidopsis thaliana>gb:AC006569_1534
JMSF010B14Sequence251005129 (4)741011545 (3)gb:AE016959_10229907e-62Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS056C06+ GGGCCAATCATCGGCCCGTCCTCCTCCTC
                      ____________________________________________________________
consensus GGGCCAATCATCGGCCCGTCCTCCTCCTC
 
. : . : . : . : . : . :
JMFS056C06+ GTCTACAGGAGGCGGCCGTGGAGGTCCAATCACGGGCACAACCTCATCCTCATCCTCCGT
                      ____________________________________________________________
consensus GTCTACAGGAGGCGGCCGTGGAGGTCCAATCACGGGCACAACCTCATCCTCATCCTCCGT
 
. : . : . : . : . : . :
JMFF009A02+ CTCCTCCTC
JMFF008F06+ CTCCTCCTC
JMFS056C06+ CGCAACTGAAGGCCGAGGTGGCCCAATCATGGCCGCCTCCTCCTTCTCTTCCTCCTCCTC
                      ____________________________________________________________
consensus CGCAACTGAAGGCCGAGGTGGCCCAATCATGGCCGCCTCCTCCTTCTCTTCCTCCTCCTC
 
. : . : . : . : . : . :
JMFF009A02+ CTCTCCATTCCCCGAATCCAAATCAGCCCCGGGCCGCGGAGGCCCAAACGTCACGCTCTT
JMFF008F06+ CTCTCCATTCCCCGAATCCAAATCAGCCCCGGGCCGCGGAGGCCCAAACGTCACGCTCTT
JMFS056C06+ CTCTCCATTCCCCGAATCCAAATCAGCCCCGGGCCGCGGAGGCCCAAACGTCACGCTCTT
                      ____________________________________________________________
consensus CTCTCCATTCCCCGAATCCAAATCAGCCCCGGGCCGCGGAGGCCCAAACGTCACGCTCTT
 
. : . : . : . : . : . :
JMFF009A02+ CTTCGAATTGCTAGGGTTAGGCTTCTTGAACGACTCTACCCAAGCTTGGGAAGTCGAAGA
JMFF008F06+ CTTCGAATTGCTAGGGTTAGGCTTCTTGAACGACTCTACCCAAGCTTGGGAAGTCGAAGA
JMFS056C06+ CTTCGAATTGCTAGGGTTAGGCTTCTTGAACGACTCTACCCAAGCTTGGGAAGTCGAAGA
                      ____________________________________________________________
consensus CTTCGAATTGCTAGGGTTAGGCTTCTTGAACGACTCTACCCAAGCTTGGGAAGTCGAAGA
 
. : . : . : . : . : . :
JMFF009A02+ TATAGATGGAAAAGGCTTATCTTTGCTCGCAGAAGAAGAGGGATTAGGTTTTCCATCGGC
JMFF008F06+ TATAGATGGAAAAGGCTTATCTTTGCTCGCAGAAGAAGAGGGATTAGGTTTTCCATCGGC
JMFS056C06+ TATAGATGGAAAAGGCTTATCTTTGCTCGCAGAAGAAGAGGGATTAGGTTTTCCATCGGC
                      ____________________________________________________________
consensus TATAGATGGAAAAGGCTTATCTTTGCTCGCAGAAGAAGAGGGATTAGGTTTTCCATCGGC
 
. : . : . : . : . : . :
JMFF009A02+ GCCGGAGCGGCGGGTGGCGCTGTGGACGATTTCGAGAGGGGTTTGAGATTGCGCTTGCTT
JMFF008F06+ GCCGGAGCGGCGGGTGGCGCTGTGGACGATTTCGAGAGGGGTTTGAGATTGCGCTTGCTT
JMFS056C06+ GCCGGAGCGGCGGGTGGCGCTGTGGACGATTTCGAGAGGGGTTTGAGATTGCGCTTGCTT
JMSF010B14+ TGCGCTTGCTT
                      ____________________________________________________________
consensus GCCGGAGCGGCGGGTGGCGCTGTGGACGATTTCGAGAGGGGTTTGAGATTGCGCTTGCTT
 
. : . : . : . : . : . :
JMFF009A02+ GCCGAAAGTTAGAGGAAACTGAGCCCTAATTCCGTCGTACATCTCCGATTCGTCCGCCAT
JMFF008F06+ GCCGAAAGTTAGAGGAAACTGAGCCCTAATTCCGTCGTACATCTCCGATTCGTCCGCCAT
JMFS056C06+ GCCGAAAGTTAGAGGAAACTGAGCCCTAATTCCGTCGTACATCTCCGATTCGTCCGCCAT
JMSF010B14+ GCCGAAAGTTAGAGGAAACTGAGCCCTAATTCCGTCGTACATCTCCGATTCGTCCGCCAT
                      ____________________________________________________________
consensus GCCGAAAGTTAGAGGAAACTGAGCCCTAATTCCGTCGTACATCTCCGATTCGTCCGCCAT
 
. : . : . : . : . : . :
JMFF009A02+ CCCGTCTTCAACACCGGCGTGTAGAGGTGATTTTATCTCGGCGTAGACTGTAGAGAAGCT
JMFF008F06+ CCCGTCTTCAACACCGGCGTGTAGAGGTGATTTTATCTCGGCGTAGACTGTAGAGAAGCT
JMFS056C06+ CCCGTCTTCAACACCGGCGTGTAGAGGTGATTTTATCTCGGCGTAGACTGTAGAGAAGCT
JMSF010B14+ CCCGTCTTCAACACCGGCGTGTAGAGGTGATTTTATCTCGGCGTAGACTGTAGAGAAGCT
                      ____________________________________________________________
consensus CCCGTCTTCAACACCGGCGTGTAGAGGTGATTTTATCTCGGCGTAGACTGTAGAGAAGCT
 
. : . : . : . : . : . :
JMFF009A02+ CCGGAGCTCTTCTGTGTTCCCACTTAC
JMFF008F06+ CCGGAGCTCTTCTGTGTTCCCACTTAC
JMFS056C06+ CCGGAGCTCTTCTGTGTTCCCACTTACAAACACCTTTTTGATTTTGAAGTCATTTATACA
JMSF010B14+ CCGGAGCTCTTCTGTGTTCCCACTTACAAACACCTTTTTGATTTTGAAGTCATTTATACA
                      ____________________________________________________________
consensus CCGGAGCTCTTCTGTGTTCCCACTTACAAACACCTTTTTGATTTTGAAGTCATTTATACA
 
. : . : . : . : . : . :
JMFS056C06+ TACCTTCTGCCGCCATAGCTCACTGTAAACCTGACCAACTATAAA
JMSF010B14+ TACCTTCTGCCGCCATAGCTCACTGTAAACCTGACCAACTATAAACTTCGTCAGCAGTTC
                      ____________________________________________________________
consensus TACCTTCTGCCGCCATAGCTCACTGTAAACCTGACCAACTATAAACTTCGTCAGCAGTTC