Previous Contig 005127:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020B19Sequence411005127 (13)gb:AY084472_15695617e-07Arabidopsis thaliana clone 108956 mRNA, complete sequence.677005127 (13)gb:AY084472_15695617e-22Arabidopsis thaliana clone 108956 mRNA, complete sequence.
JMFF029N11Sequence582005127 (13)gb:AY084472_15695612e-31Arabidopsis thaliana clone 108956 mRNA, complete sequence.717005127 (13)gb:AY084472_15695614e-38Arabidopsis thaliana clone 108956 mRNA, complete sequence.
JMFF048K19Sequence389005127 (13)gb:AY084472_15695617e-10Arabidopsis thaliana clone 108956 mRNA, complete sequence.575005127 (13)gb:OSJN00017_16933350.004Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0017I01, complete seque
JMFN004B06Sequence574005127 (13)gb:AY084472_15695612e-08Arabidopsis thaliana clone 108956 mRNA, complete sequence.
JMSF010B11Sequence225005127 (13)759005127 (13)gb:AY084472_15695617e-48Arabidopsis thaliana clone 108956 mRNA, complete sequence.
JMSF014I03Sequence231005127 (13)771005127 (13)gb:AY084472_15695612e-48Arabidopsis thaliana clone 108956 mRNA, complete sequence.
JMSF029B11Sequence658005127 (13)gb:AY084472_15695615e-51Arabidopsis thaliana clone 108956 mRNA, complete sequence.780005127 (13)gb:AY084472_15695613e-34Arabidopsis thaliana clone 108956 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048K19- GCCGGAT
                      ____________________________________________________________
consensus GCCGGAT
 
. : . : . : . : . : . :
rJMFF048K19- CACCCTGGCGAGTTTTTTTTTTTTTTTTAGAAAAGCAATACAAAAATTTTATTGACCGGT
rJMFF020B19- GT
                      ____________________________________________________________
consensus CACCCTGGCGAGTTTTTTTTTTTTTTTTAGAAAAGCAATACAAAAATTTTATTGACCGGT
 
. : . : . : . : . : . :
rJMFF048K19- TGAAAACGAAAATACTCCATAACCGATAAATGAGGGTCAATACACAACAATAAACTGAAT
JMFN004B06+ AACCGATAAATGAGGGTCAATACACAACAATAAACTGAAT
rJMFF020B19- TGAAAACGAAAATACTCCATAACCGATAAATGAGGGTCAATACACAACAATAAACTGAAT
rJMSF029B11- CAACAATAAACTGAAT
                      ____________________________________________________________
consensus TGAAAACGAAAATACTCCATAACCGATAAATGAGGGTCAATACACAACAATAAACTGAAT
 
. : . : . : . : . : . :
rJMFF048K19- ACTAGGAAACAGATCTCCACAATCTGAACAGAGTAACGAAGGTCTACAATCAAATGCAAT
JMFN004B06+ ACTAGGAAACAGATCTCCACAATCTGAACAGAGTAACGAAGGTCTACAATCAAATGCAAT
rJMFF020B19- ACTAGGAAACAGATCTCCACAATCTGAACAGAGTAACGAAGGTCTACAATCAAATGCAAT
rJMFF029N11- ATCTGAACAGAGTAACGAAGGTCTACAATCAAATGCAAT
rJMSF029B11- ACTAGGAAACAGATCTCCACAATCTGAACAGAGTAACGAAGGTCTACAATCAAATGCAAT
rJMSF010B11- ACGAAGGTCTACAATCAAATGCAAT
rJMSF014I03- ATCAAATGCAAT
                      ____________________________________________________________
consensus ACTAGGAAACAGATCTCCACAATCTGAACAGAGTAACGAAGGTCTACAATCAAATGCAAT
 
. : . : . : . : . : . :
rJMFF048K19- TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
JMFN004B06+ TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
rJMFF020B19- TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
rJMFF029N11- TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
rJMSF029B11- TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
rJMSF010B11- TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
rJMSF014I03- TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
                      ____________________________________________________________
consensus TGTAGTAGAATGCAAGATTAATAAGTGAGACAATCATACAAAATTCGTGCACGGCGAAAA
 
. : . : . : . : . : . :
rJMFF048K19- ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
JMFN004B06+ ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
rJMFF020B19- ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
rJMFF029N11- ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
rJMSF029B11- ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
rJMSF010B11- ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
rJMSF014I03- ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
                      ____________________________________________________________
consensus ACAAAAAACAAAGTCCACAGACATATTAGAAGATTCAAGTAGAGGGCTGTTCCTCTGTGA
 
. : . : . : . : . : . :
rJMFF048K19- CGGTGGCAGGTTCTTCCGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
JMFN004B06+ CGGTGGCAGGTTCTTCCGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
rJMFF020B19- CGGTGGCAGGTTCTTCCGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
rJMFF029N11- CGGTGGCAGGTTCTTCCGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
rJMSF029B11- CGGTGGCAGGTTCTTACGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
rJMSF010B11- CGGTGGCAGGTTCTTCCGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
rJMSF014I03- CGGTGGCAGGTTCTTCCGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
                      ____________________________________________________________
consensus CGGTGGCAGGTTCTTCCGATGCAGGAGCAGGCGTTTTAGAATCGCTGACAGGTGGAGCTG
 
. : . : . : . : . : . :
rJMFF048K19- CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
JMFN004B06+ CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
rJMFF020B19- CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
rJMFF029N11- CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
rJMSF029B11- CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
rJMSF010B11- CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
rJMSF014I03- CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
                      ____________________________________________________________
consensus CTGCTGCAGCTGCAGATGGTTCTGCTTCTTTCGCATCCTTGACATTTTTCCCATCCTTGG
 
. : . : . : . : . : . :
rJMFF048K19- CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
JMFN004B06+ CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
rJMFF020B19- CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
rJMFF029N11- CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
rJMSF029B11- CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
rJMSF010B11- CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
rJMSF014I03- CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
                      ____________________________________________________________
consensus CGTCTTTCGTATCCTTCTTCCCGTCTTTGCCATCCTTGGGAGCGGGAGGGGGTGGTAACA
 
. : . : . : . : . : . :
rJMFF048K19- TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
JMFN004B06+ TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
rJMFF020B19- TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
rJMFF029N11- TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
rJMSF029B11- TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
rJMSF010B11- TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
rJMSF014I03- TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
                      ____________________________________________________________
consensus TGTGAGGTGGTGGCTTATGCTTAAGCTTCACCAGTATTTGGCGCATCCTTGAAAGCTCGG
 
. : . : . : . : . : . :
rJMFF048K19- TGGGTTTTCCAGGTTTCGGCCCTTGGAT
JMFN004B06+ TGGGTTTTCCAGGTTTCGGCCCTTGGATCACAGTGATACCTGGCTTCTTCTCTTGATCCT
rJMFF020B19- TGGGTTTTCCAGGTTTCGGCCCTTGGATCACAGTGATACCTGGCTTCTTCTCTTGATCCT
rJMFF029N11- TGGGTTTTCCAGGTTTCGGCCCTTGGATCACAGTGATACCTGGCTTCTTCTCTTGATCCT
rJMSF029B11- TGGGTTTTCCAGGTTTCGGCCCTTGGATCACAGTGATACCTGGCTTCTTCTCTTGATCCT
rJMSF010B11- TGGGTTTTCCAGGTTTCGGCCCTTGGATCACAGTGATACCTGGCTTCTTCTCTTGATCCT
rJMSF014I03- TGGGTTTTCCAGGTTTCGGCCCTTGGATCACAGTGATACCTGGCTTCTTCTCTTGATCCT
                      ____________________________________________________________
consensus TGGGTTTTCCAGGTTTCGGCCCTTGGATCACAGTGATACCTGGCTTCTTCTCTTGATCCT
 
. : . : . : . : . : . :
JMFN004B06+ TCTTCCTACCCTTCTTCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAA
rJMFF020B19- TCTTCCTACCCTTCTTCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAATAGCTT
rJMFF029N11- TCTTCCTACCCTTCTTCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAATAGCTT
rJMSF029B11- TCTTCCTACCCTTCTTCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAATAGCTT
rJMSF010B11- TCTTCCTACCCTTCTTCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAATAGCTT
rJMSF014I03- TCTTCCTACCCTTCTTCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAATAGCTT
JMSF029B11+ TCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAATAGCTT
                      ____________________________________________________________
consensus TCTTCCTACCCTTCTTCTCAATGTTGGGCACCTCATTAGGAATGAGCTCAGCAATAGCTT
 
. : . : . : . : . : . :
rJMFF020B19- TCCAGTATTGCTTATCAGCTTCTTTATGGAACTTCTCTTGACTAGCTAAGGATAACTTCT
rJMFF029N11- TCCAGTATTGCTTATCAGCTTCTTTATGGAACTTCTCTTGACTAGCTAAGGATAACTTCT
rJMSF029B11- TCCAGTATTGCTTATCAGCTTCTTTATGGAACTTCTCTTGACTAGCTAAGGATAACTTCT
rJMSF010B11- TCCAGTATTGCTTATCAGCTTCTTTATGGAACTTCTCTTGACTAGCTAAGGATAACTTCT
rJMSF014I03- TCCAGTATTGCTTATCAGCTTCTTTATGGAACTTCTCTTGACTAGCTAAGGATAACTTCT
JMSF029B11+ TCCAGTATTGCTTATCAGCTTCTTTATGGAACTTCTCTTGACTAGCTAAGGATAACTTCT
                      ____________________________________________________________
consensus TCCAGTATTGCTTATCAGCTTCTTTATGGAACTTCTCTTGACTAGCTAAGGATAACTTCT
 
. : . : . : . : . : . :
rJMFF020B19- CTTTTTCCCTGTTAA
rJMFF029N11- CTTTTTCCCTGTTAATGGTCATATTAGTTTCAATATTGAGCTTTCTTTTTTCATAGAAAG
rJMSF029B11- CTTTTTCCCTGTTAATGGTCATATTAGTTTCAATATTGAGCTTTCTTTTTTCATAGAAAG
rJMSF010B11- CTTTTTCCCTGTTAATGGTCATATTAGTTTCAATATTGAGCTTTCTTTTTTCATAGAAAG
rJMSF014I03- CTTTTTCCCTGTTAATGGTCATATTAGTTTCAATATTGAGCTTTCTTTTTTCATAGAAAG
JMSF029B11+ CTTTTTCCCTGTTAATGGTCATATTAGTTTCAATATTGAGCTTTCTTTTTTCATAGAAAG
JMFF029N11+ TGGTCATATTAGTTTCAATATTGAGCTTTCTTTTTTCATAGAAAG
                      ____________________________________________________________
consensus CTTTTTCCCTGTTAATGGTCATATTAGTTTCAATATTGAGCTTTCTTTTTTCATAGAAAG
 
. : . : . : . : . : . :
rJMFF029N11- CTCTCTTATACTCTTCTCCTTCTTCAATAATTTGGTTTCTTATTT-CCTTTTCCTGCTTT
rJMSF029B11- CTCTCTTATACTCTTCTCCTTCTTCAATAATTTGGTTTCTTATTTCCCTTTTCCTGCTTT
rJMSF010B11- CTCTCTTATACTCTTCTCCTTCTTCAATAATTTGGTTTCTTATTT-CCTTTTCCTGCTTT
rJMSF014I03- CTCTCTTATACTCTTCTCCTTCTTCAATAATTTGGTTTCTTATTT-CCTTTTCCTGCTTT
JMSF029B11+ CTCTCTTATACTCTTCTCCTTCTTCAATAATTTGGTTTCTTATTT-CCTTTTCCTGCTTT
JMFF029N11+ CTCTCTTATACTCTTCTCCTTCTTCAATAATTTGGTTTCTTATTT-CCTTTTCCTGCTTT
                      ____________________________________________________________
consensus CTCTCTTATACTCTTCTCCTTCTTCAATAATTTGGTTTCTTATTT-CCTTTTCCTGCTTT
 
. : . : . : . : . : . :
rJMFF029N11- TCCTTCTCCTCAAGTCGAA
rJMSF029B11- TCCTTCTCCTCANGTCGAATGGTGTTTAGCCTTCGCCATTCGCG
rJMSF010B11- TCCTTCTCCTCAAGTCGAATGGTGTTTAGCCTTCGCCATTCGCGCAGAGCAAAGCCTTCC
rJMSF014I03- TCCTTCTCCTCAAGTCGAATGGTGTTTAGCCTTCGCCATTCGCGCAGAGCAGAGCCTTCC
JMFF048K19+ AGAGCAGAGCCTTCC
JMSF029B11+ TCCTTCTCCTCAAGTCGAATGGTGTTTAGCCTTCGCCATTCGCGCAGAGCAGAGCCTTCC
JMFF029N11+ TCCTTCTCCTCAAGTCGAATGGTGTTTAGCCTTCGCCATTCGCGCAGAGCAGAGCCTTCC
                      ____________________________________________________________
consensus TCCTTCTCCTCAAGTCGAATGGTGTTTAGCCTTCGCCATTCGCGCAGAGCAGAGCCTTCC
 
. : . : . : . : . : . :
rJMSF010B11- TCTCGCATTTCAT
rJMSF014I03- TCTCGCATTTCATTCGGAAGGAGNAAGCACCGGTCCATCG
JMFF048K19+ TCTCGCATTTCATTCGG-AGGAGGAAGCACCGGTCCATCGGAGCTGAATATTCCCTCGGA
JMSF029B11+ TCTCGCATTTCATTCGG-AGGAGGAAGCACCGGTCCATCGGAGCTGAATATTCCCTCGGA
JMFF029N11+ TCTCGCATTTCATTCGG-AGGAGGAAGCACCGGTCCATCGGAGCTGAATATTCCCTCGGA
JMFF020B19+ TTTCATTCGG-AGGAGGAAGCACCGGTCCATCGGAGCTGAATATTCCCTCGGA
                      ____________________________________________________________
consensus TCTCGCATTTCATTCGG-AGGAGGAAGCACCGGTCCATCGGAGCTGAATATTCCCTCGGA
 
. : . : . : . : . : . :
JMFF048K19+ GTCTTCCCCAAGGTCATAGGGCTTTCCATTTCCGTTGGAAACCGGAACGGCCGAGGATCC
JMSF029B11+ GTCTTCCCCAAGGTCATAGGGCTTTCCATTTCCGTTGGAAACCGGAACGGCCGAGGATCC
JMFF029N11+ GTCTTCCCCAAGGTCATAGGGCTTTCCATTTCCGTTGGAAACCGGAACGGCCGAGGATCC
JMFF020B19+ GTCTTCCCCAAGGTCATAGGGCTTTCCATTTCCGTTGGAAACCGGAACGGCCGAGGATCC
                      ____________________________________________________________
consensus GTCTTCCCCAAGGTCATAGGGCTTTCCATTTCCGTTGGAAACCGGAACGGCCGAGGATCC
 
. : . : . : . : . : . :
JMFF048K19+ AAACGGAGTGGCCTGTCCCTGGAACGGATCAGACTCGAATCTGTAAGGATCAGGGCTGTC
JMSF029B11+ AAACGGAGTGGCCTGTCCCTGGAACGGATCAGACTCGAATCTGTAAGGATCAGGGCTGTC
JMFF029N11+ AAACGGAGTGGCCTGTCCCTGGAACGGATCAGACTCGAATCTGTAAGGATCAGGGCTGTC
JMFF020B19+ AAACGGAGTGGCCTGTCCCTGGAACGGATCAGACTCGAATCTGTAAGGATCAGGGCTGTC
                      ____________________________________________________________
consensus AAACGGAGTGGCCTGTCCCTGGAACGGATCAGACTCGAATCTGTAAGGATCAGGGCTGTC
 
. : . : . : . : . : . :
JMFF048K19+ GACGGTTTCAGATGCCTGTTCCGCCGTCACTTCAACGTAGTCCTCAGACAATTCCGCAGC
JMSF029B11+ GACGGTTTCAGATGCCTGTTCCGCCGTCACTTCAACGTAGTCCTCAGACAATTCCGCAGC
JMFF029N11+ GACGGTTTCAGATGCCTGTTCCGCCGTCACTTCAACGTAGTCCTCAGACAATTCCGCAGC
JMFF020B19+ GACGGTTTCAGATGCCTGTTCCGCCGTCACTTCAACGTAGTCCTCAGACAATTCCGCAGC
JMSF014I03+ AGATGCCTGTTCCGCCGTCACTTCAACGTAGTCCTCAGACAATTCCGCAGC
JMSF010B11+ CTGTTCCGCCGTCACTTCAACGTAGTCNTCAGACAATTCCGCAGC
                      ____________________________________________________________
consensus GACGGTTTCAGATGCCTGTTCCGCCGTCACTTCAACGTAGTCCTCAGACAATTCCGCAGC
 
. : . : . : . : . : . :
JMFF048K19+ AGGTTGGTACGGCGGCGTTTCGGATGAGAAAGCCGAGTAGCCGCCATAGCTACCGTCTTC
JMSF029B11+ AGGTTGGTACGGCGGCGTTTCGGATGAGAAAGCCGAGTAGCCGCCATAGCTACCGTCTTC
JMFF029N11+ AGGTTGGTACGGCGGCGTTTCGGATGAGAAAGCCGAGTAGCCGCCATAGCTACCGTCTTC
JMFF020B19+ AGGTTGGTACGGCGGCGTTTCGGATGAGAAAGCCGAGTAGCCGCCATAGCTACCGTCTTC
JMSF014I03+ AGGTTGGTACGGCGGCGTTTCGGATGAGAAAGCCGAGTAGCCGCCATAGCTACCGTCTTC
JMSF010B11+ AGGTTGGTACGGCGGCGTTTCGGATGAGAAAGCCGAGTAGCCGCCATAGCTACCGTCTTC
                      ____________________________________________________________
consensus AGGTTGGTACGGCGGCGTTTCGGATGAGAAAGCCGAGTAGCCGCCATAGCTACCGTCTTC
 
. : . : . : . : . : . :
JMFF048K19+ AAACGGAGGCGGTGGCGTCGCGTGCTCTCCGTCCATGCTAAAGGTGTCAAACGAAGCCAT
JMSF029B11+ AAACGGAGGCGGTGGCGTCGCGTGCTCTCCGTCCATGCTAAAGGTGTCAAACGAAGCCAT
JMFF029N11+ AAACGGAGGCGGNGGCGTCGCGTGCTCTCCGTCCATGCTAAAGGTGTCAAACGAAGCCAT
JMFF020B19+ AAACGGAGGCGGTGGCGTCGCGTGCTCTCCGTCCATGCTAAAGGTGTCAAACGAAGCCAT
JMSF014I03+ AAACGGAGGCGGTGGCGTCGCGTGCTCTCCGTCCATGCTAAAGGTGTCAAACGAAGCCAT
JMSF010B11+ AAACGGAGGCGGTGGCGTCGCGTGCTCTCCGTCCATGCTAAAGGTGTCAAACGAAGCCAT
                      ____________________________________________________________
consensus AAACGGAGGCGGTGGCGTCGCGTGCTCTCCGTCCATGCTAAAGGTGTCAAACGAAGCCAT
 
. : . : . : . : . : . :
JMFF048K19+ TCTCTCTCTCT
JMSF029B11+ TCTCTCTCTCTCT
JMFF029N11+ TCTCTCTCTCTCTACAAAATCCCAGATCTTTAGCTCTCTCTAAATATGCGTGTGCCTGT
JMFF020B19+ TCTCTCTCTCTCTACAAAATCCCAGATCTTTAGCTCTCTCTAAATATGCGTGTGCCTGT
JMSF014I03+ TCTCTCTCTCTCTACAAAATCCCAGATCTTTAGCTCTCTCTAAATATGCGTGTGCCTGT
JMSF010B11+ TCTCTCTCTCTCTACAAAATCCCAGATCTTTAGCTCTCTCTAAATATGCGTGTGCCTGTA
                      ____________________________________________________________
consensus TCTCTCTCTCTCTACAAAATCCCAGATCTTTAGCTCTCTCTAAATATGCGTGTGCCTGTA