Previous Contig 005126:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041H05Sequence647005126 (3)gb:AP003714_18323671e-73Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P065600012329 (3)gb:AF097668_17678946e-72Mesembryanthemum crystallinum T-complex protein 1 epsilon subunit (TCP-1-EPSILON
JMSF010B02Sequence286005126 (3)gb:AP003714_18323673e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P065736012329 (3)gb:AF097668_1767894e-103Mesembryanthemum crystallinum T-complex protein 1 epsilon subunit (TCP-1-EPSILON
JMSF023O13Sequence696005126 (3)gb:AP003714_18323677e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P065741012329 (3)gb:AF097668_1767894e-101Mesembryanthemum crystallinum T-complex protein 1 epsilon subunit (TCP-1-EPSILON

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023O13+ ATCTTAGATGACAAAGTAGTCATGCATGTTTGAACTA
                      ____________________________________________________________
consensus ATCTTAGATGACAAAGTAGTCATGCATGTTTGAACTA
 
. : . : . : . : . : . :
JMFF041H05+ ATTCACACCAAATTCAAATTTATGTGCTATGTGTTCGAGATGCTCAA
JMSF023O13+ AAGGCTCAAAATTATTCACACCAAATTCAAATTTATGTGCTATGTGTTCGAGATGCTCAA
                      ____________________________________________________________
consensus AAGGCTCAAAATTATTCACACCAAATTCAAATTTATGTGCTATGTGTTCGAGATGCTCAA
 
. : . : . : . : . : . :
JMFF041H05+ CTGCAATCCTTGATGCCATTTCATAACCCTCAGCAATACGAATAGGATGAATGCCACGTT
JMSF023O13+ CTGCAATCCTTGATGCCATTTCATAACCCTCAGCAATACGAATAGGATGAATGCCACGTT
                      ____________________________________________________________
consensus CTGCAATCCTTGATGCCATTTCATAACCCTCAGCAATACGAATAGGATGAATGCCACGTT
 
. : . : . : . : . : . :
JMFF041H05+ CCAACAACTTTTCGGCTTGTTCAAGAAGTGCCCCTGCCATGACAACAACTCCAGTTGTTC
JMSF023O13+ CCAACAACTTTTCGGCTTGTTCAAGAAGTGCCCCTGCCATGACAACAACTCCAGTTGTTC
                      ____________________________________________________________
consensus CCAACAACTTTTCGGCTTGTTCAAGAAGTGCCCCTGCCATGACAACAACTCCAGTTGTTC
 
. : . : . : . : . : . :
JMFF041H05+ CATCACCAATCTCATAGTCCTGACTCCGTGACAATTCTACCATTAGCTTTGCGATCTGGT
JMSF023O13+ CATCACCAATCTCATAGTCCTGACTCCGTGACAATTCTACCATTAGCTTTGCGATCTGGT
                      ____________________________________________________________
consensus CATCACCAATCTCATAGTCCTGACTCCGTGACAATTCTACCATTAGCTTTGCGATCTGGT
 
. : . : . : . : . : . :
JMFF041H05+ TGTCAACATCCATCTGCTCCAAGATGGTTGCACCATCATTTGAGATGATAACGTCTCCGT
JMSF023O13+ TGTCAACATCCATCTGCTCCAAGATGGTTGCACCATCATTTGAGATGATAACGTCTCCGT
                      ____________________________________________________________
consensus TGTCAACATCCATCTGCTCCAAGATGGTTGCACCATCATTTGAGATGATAACGTCTCCGT
 
. : . : . : . : . : . :
JMFF041H05+ CGGGGCTCTGGAGCATCTTGTCCATGCCTTTGGGACCGAGTGAGGTCCGGAGGATCCGAG
JMSF023O13+ CGGGGCTCTGGAGCATCTTGTCCATGCCTTTGGGACCGAGTGAGGTCCGGAGGATCCGAG
                      ____________________________________________________________
consensus CGGGGCTCTGGAGCATCTTGTCCATGCCTTTGGGACCGAGTGAGGTCCGGAGGATCCGAG
 
. : . : . : . : . : . :
JMFF041H05+ CGACGGCCTTGCCGGCGGAAATGTTGGCCTTCTGAGCATCGAGGCCACGCAGCCTCGACT
JMSF023O13+ CGACGGCCTTGCCGGCGGAAATGTTGGCCTTCTGAGCATCGAGGCCACGCAGCCTCGACT
JMSF010B02+ GCGGAAATGTTGGCCTTCTGAGCATCGAGGCCACGCAGCCTCGACT
                      ____________________________________________________________
consensus CGACGGCCTTGCCGGCGGAAATGTTGGCCTTCTGAGCATCGAGGCCACGCAGCCTCGACT
 
. : . : . : . : . : . :
JMFF041H05+ TCTGTTCCTGTTCCTTCAGTATTATAAAGGGCCTCCCGTATTCATCCATCACCAACGCCA
JMSF023O13+ TCTGTTCCTGTTCCTTCAGTATTATAAAGGGCCTCCCGTATTCATCCATCACCAACGCCA
JMSF010B02+ TCTGTTCCTGTTCCTTCAGTATTATAAAGGGCCTCCCGTATTCATCCATCACCAACGCCA
                      ____________________________________________________________
consensus TCTGTTCCTGTTCCTTCAGTATTATAAAGGGCCTCCCGTATTCATCCATCACCAACGCCA
 
. : . : . : . : . : . :
JMFF041H05+ TTGCTGCTTCTTTCTGATCGGATCTTGAGCAGATTGGAAACGAACTCTTACTCAGCTGTA
JMSF023O13+ TTGCTGCTTCTTTCTGATCGGATCTTGAGCAGATTGGAAACGAACTCTTACTCAGCTGTA
JMSF010B02+ TTGCTGCTTCTTTCTGATCGGATCTTGAGCAGATTGGAAACGAACTCTTACTCAGCTGTA
                      ____________________________________________________________
consensus TTGCTGCTTCTTTCTGATCGGATCTTGAGCAGATTGGAAACGAACTCTTACTCAGCTGTA
 
. : . : . : . : . : . :
JMFF041H05+ GATAGAAGAAGAGTACAGACTGTGAGAAGTGAGATGAAGAAGAGATTGTGAATCTCTTTC
JMSF023O13+ GATAGAAGAAGAGTACAGACTGTGAGAAGTGAGATGAAGAAGAGATTGTGAATCTCTTTC
JMSF010B02+ GATAGAAGAAGAGTACAGACTGTGAGAAGTGAGATGAAGAAGAGATTGTGAATCTCTTTC
                      ____________________________________________________________
consensus GATAGAAGAAGAGTACAGACTGTGAGAAGTGAGATGAAGAAGAGATTGTGAATCTCTTTC
 
. : . : . : . : . : . :
JMFF041H05+ GTCTAGAAACTTTCACAAGTCGGTTTTTGTTTTGCCCTAGCTAGCTTGAGCTTCCCT
JMSF023O13+ GTCTAGAAACTTTCACAAGTCGGTTTTTGTTTTGCCCTAGCTAGCTTGAGCTTCCCT
JMSF010B02+ GTCTAGAAACTTTCACAAGTCGGTTTTTGTTTTGCCCTAGCTAGCTTGAGCTTCCCTCCC
                      ____________________________________________________________
consensus GTCTAGAAACTTTCACAAGTCGGTTTTTGTTTTGCCCTAGCTAGCTTGAGCTTCCCTCCC