Previous Contig 005125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017P08Sequence560005125 (29)pir|A26014|A260146e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI671005125 (29)pir|A26014|A260149e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFN006B18Sequence626005125 (29)pir|A26014|A260147e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFN006P14Sequence592005125 (29)pir|A26014|A260142e-54histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMFN034P10Sequence595005125 (29)pir|A26014|A260147e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF006N13Sequence345005474 (26)299005125 (29)gb:ALFHISH3A_18189773e-16Alfalfa histone H3 (H3-1.1) gene, complete cds.
JMSF006P15Sequence207005125 (29)gb:AY647982_21458589e-21Yeast two-hybrid vector pDG2, complete sequence.340008432 (2)sp|Q9M0Y6|DPNM_ARATH2e-14Putative PAP-specific phosphatase, mitochondrial precursor (3'(2'),5'- bisphosph
JMSF010A20Sequence281005125 (29)gb:ALFHISH3A_18189774e-34Alfalfa histone H3 (H3-1.1) gene, complete cds.651005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF015K06Sequence566005125 (29)pir|A26014|A260146e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI651005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF018P14Sequence473005125 (29)pir|A26014|A260144e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI651005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF019A01Sequence516005125 (29)pir|A26014|A260145e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI651005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF023F02Sequence695005125 (29)pir|A26014|A260149e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI680005125 (29)pir|A26014|A260149e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF027D22Sequence616005125 (29)pir|A26014|A260147e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI650005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF035B15Sequence688005125 (29)pir|A26014|A260149e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI650005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF036E18Sequence669005125 (29)pir|A26014|A260149e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI643005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF048O17Sequence612005125 (29)pir|A26014|A260147e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI650005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF052O18Sequence673005125 (29)pir|A26014|A260149e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI651005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI
JMSF053O23Sequence584005125 (29)pir|A26014|A260146e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI651005125 (29)pir|A26014|A260148e-60histone H3 - wheat>pir|S04520|S04520 histone H3 (clone pH3c-1) - alfalfa>gb:MSHI

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017P08- TTAACCAGGA
JMSF023F02+ TCCAGATGGCAGAAAACTTGATAAATTTCATTAACCAGGA
JMSF052O18+ ATTTCATTAACCAGGA
JMSF036E18+ CATTAACCAGGA
                      ____________________________________________________________
consensus TCCAGATGGCAGAAAACTTGATAAATTTCATTAACCAGGA
 
. : . : . : . : . : . :
rJMSF006N13- TA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
JMFN006B18+ AATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
JMFN034P10+ TTCAACAATGCTG
JMFN006P14+ AACAATGCTG
rJMFF017P08- TAACCTAAATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
JMSF023F02+ TAACCTAAATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
JMSF052O18+ TAACCTAAATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF035B15- AATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF027D22- AATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF053O23- AAATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF048O17- AATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF052O18- AATTTTCACTAGGCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF018P14- AATTTTCACTA-GCACAGTGGACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF019A01- AATTTTCACTA-GCACAGGTGACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF036E18- CTA-GCACAGGTGACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF015K06- AATTTTCACTA-GCACAGGTGACTACACGTCTACATATCTTTCAACAATGCTG
rJMSF010A20- AATTTTCACTA-GCACAGTGGACTACACGTCTACATACCTTTCAACAATGCTG
JMSF048O17+ TTCAACAATGCTG
JMSF036E18+ TAACCTAAATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
JMSF027D22+ ATCTTTCAACAATGCTG
                      ____________________________________________________________
consensus TAACCTAAATTTTCACTA-GCACAGT-GACTACACGTCTACATATCTTTCAACAATGCTG
 
. : . : . : . : . : . :
rJMSF006N13- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMFN006B18+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMFN034P10+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMFN006P14+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMFF017P08- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMSF023F02+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMSF052O18+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF035B15- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF027D22- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF053O23- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF048O17- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCGCAGTAAG
rJMSF052O18- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF018P14- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF019A01- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF036E18- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
rJMSF015K06- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMFF017P08+ ACCAGGAAAAGCAGCACAGTAAG
rJMSF010A20- CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMSF048O17+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCGCAGTAAG
JMSF053O23+ TTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMSF036E18+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMSF027D22+ CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
JMSF015K06+ ACATACCAGGAAAAGCAGCACAGTAAG
                      ____________________________________________________________
consensus CAGGAACCCTAGAATTTACACCATTCTAACACCACATACCAGGAAAAGCAGCACAGTAAG
 
. : . : . : . : . : . :
rJMSF006N13- CAAACACAANACAGAACAGACTACTACGCGACAGAAACTGAAATCAACCAGATTATCANA
JMFN006B18+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMFN034P10+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMFN006P14+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMFF017P08- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF023F02+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF052O18+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF035B15- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF027D22- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF053O23- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF048O17- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF052O18- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF018P14- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF019A01- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF036E18- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF015K06- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMFF017P08+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
rJMSF010A20- CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF048O17+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF053O23+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF036E18+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF027D22+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF019A01+ CTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
JMSF015K06+ CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
                      ____________________________________________________________
consensus CAAACACAAAACAGAACAGACTACTACGCAACAGAAACTGAAATCAACCAGATTATCAAA
 
. : . : . : . : . : . :
rJMSF006N13- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMFN006B18+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMFN034P10+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMFN006P14+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMFF017P08- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF023F02+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF052O18+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF035B15- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF027D22- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF053O23- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF048O17- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF052O18- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF018P14- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF019A01- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF036E18- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF015K06- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMFF017P08+ CTTCAACCTAAAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF010A20- CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF048O17+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF053O23+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF036E18+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF035B15+ T-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF027D22+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF019A01+ CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF018P14+ T-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
rJMSF023F02- T-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
JMSF015K06+ CTTCAACNT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
                      ____________________________________________________________
consensus CTTCAACCT-AAGCCCTCTCGCCACGAATCCTCCTAGCGAGCTGAATATCCTTAGGCATA
 
. : . : . : . : . : . :
rJMSF006N13- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMFN006B18+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMFN034P10+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMFN006P14+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMFF017P08- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF023F02+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF052O18+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF035B15- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF027D22- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF053O23- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF048O17- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF052O18- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF018P14- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF019A01- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF036E18- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF015K06- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMFF017P08+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF010A20- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF048O17+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF053O23+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF036E18+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF035B15+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF027D22+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF019A01+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF018P14+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
rJMSF023F02- ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
JMSF015K06+ ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
                      ____________________________________________________________
consensus ATGGTGACTCTCTTGGCGTGAATAGCGCAAAGGTTGGTGTCCTCGAAGAGTCCGACGAGG
 
. : . : . : . : . : . :
rJMSF006N13- TAGGCCTCCGCCGCCTCC
JMFN006B18+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMFN034P10+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMFN006P14+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMFF017P08- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF023F02+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF052O18+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF035B15- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF027D22- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF053O23- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF048O17- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF052O18- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF018P14- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF019A01- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF036E18- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF015K06- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMFF017P08+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF010A20- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF048O17+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF053O23+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF036E18+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF035B15+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF027D22+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF019A01+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF018P14+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
rJMSF023F02- TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
JMSF015K06+ TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
                      ____________________________________________________________
consensus TAGGCCTCCGCCGCCTCCTGGAGTGCCGCGACGGCGCTGCTCTGGAACCTAAGATCGGTT
 
. : . : . : . : . : . :
JMFN006B18+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMFN034P10+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMFN006P14+ TTGAAATCCTGCGCAATCTCTCTAACGAG--TCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMFF017P08- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF023F02+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF052O18+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF035B15- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF027D22- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF053O23- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF048O17- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF052O18- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF018P14- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF019A01- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF036E18- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF015K06- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMFF017P08+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF010A20- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF048O17+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF053O23+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF036E18+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF035B15+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF027D22+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF019A01+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF018P14+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
rJMSF023F02- TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF015K06+ TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
JMSF010A20+ CTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
                      ____________________________________________________________
consensus TTGAAATCCTGCGCAATCTCTCTAACGAGTCTCTGGAACGGCAGCTTTCGGATCAGGAGC
 
. : . : . : . : . : . :
JMFN006B18+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMFN034P10+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMFN006P14+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMFF017P08- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF023F02+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF052O18+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF035B15- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF027D22- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF053O23- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF048O17- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF052O18- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF018P14- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF019A01- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF036E18- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF015K06- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMFF017P08+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF010A20- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF048O17+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF053O23+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF036E18+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF035B15+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF027D22+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF019A01+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF018P14+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
rJMSF023F02- TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF006P15+ TCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF015K06+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
JMSF010A20+ TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
                      ____________________________________________________________
consensus TCGGTGGACTTCTGATACTTCCGGATCTCCCTCAGAGCCACCGTCCCTGGACGGAAACGG
 
. : . : . : . : . : . :
JMFN006B18+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMFN034P10+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMFN006P14+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMFF017P08- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF023F02+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF052O18+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF035B15- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF027D22- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF053O23- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF048O17- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF052O18- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF018P14- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF019A01- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF036E18- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF015K06- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMFF017P08+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF010A20- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF048O17+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF053O23+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF036E18+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF035B15+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF027D22+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF019A01+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF018P14+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
rJMSF023F02- TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF006P15+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF015K06+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
JMSF010A20+ TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
                      ____________________________________________________________
consensus TGGGGCTTCTTCACTCCGCCGGTGGCCGGAGCAGATTTCCTTGCGGCCTTGGTGGCCAGC
 
. : . : . : . : . : . :
JMFN006B18+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMFN034P10+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMFN006P14+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMFF017P08- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF023F02+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF052O18+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF035B15- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF027D22- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF053O23- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF048O17- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF052O18- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF018P14- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF019A01- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF036E18- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF015K06- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMFF017P08+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF010A20- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF048O17+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF053O23+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF036E18+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF035B15+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF027D22+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF019A01+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF018P14+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
rJMSF023F02- TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF006P15+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF015K06+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
JMSF010A20+ TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
                      ____________________________________________________________
consensus TGCTTCCGGGGAGCCTTTCCTCCGGTCGACTTGCGAGCTGTCTGCTTGGTACGTGCCATT
 
. : . : . : . : . : . :
JMFN006B18+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTG
JMFN034P10+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAAT
JMFN006P14+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTG
rJMFF017P08- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATG
JMSF023F02+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTT
JMSF052O18+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF035B15- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF027D22- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF053O23- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTG
rJMSF048O17- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF052O18- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF018P14- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF019A01- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF036E18- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF015K06- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMFF017P08+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTT
rJMSF010A20- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMSF048O17+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMSF053O23+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTG
JMSF036E18+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMSF035B15+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMSF027D22+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMSF019A01+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMSF018P14+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
rJMSF023F02- GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTT
JMSF006P15+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTT
JMSF015K06+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
JMSF010A20+ GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC
                      ____________________________________________________________
consensus GGAACGATTGAAAGCTCAAATTGTATGTATAGATTGCAGAAATTGCTATGAATGCTTGTC