Previous Contig 005119:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007G02Sequence603005119 (7)gb:AY568718_16154769e-41Lycopersicon esculentum unknown protein mRNA, complete cds.
JMFN010D12Sequence453005119 (7)gb:AY085732_15707992e-35Arabidopsis thaliana clone 17482 mRNA, complete sequence.
JMFN016H05Sequence616005119 (7)gb:AY568718_16154767e-44Lycopersicon esculentum unknown protein mRNA, complete cds.
JMSF010A01Sequence299005119 (7)gb:AY085732_15707996e-06Arabidopsis thaliana clone 17482 mRNA, complete sequence.759005119 (7)gb:AY568718_16154762e-45Lycopersicon esculentum unknown protein mRNA, complete cds.
JMSF020L04Sequence648005119 (7)gb:AY568718_16154765e-41Lycopersicon esculentum unknown protein mRNA, complete cds.752005119 (7)gb:AY568718_16154761e-44Lycopersicon esculentum unknown protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010A01- ATAAAACAAA
                      ____________________________________________________________
consensus ATAAAACAAA
 
. : . : . : . : . : . :
rJMSF010A01- ATTTAAATGTGGTACTTGGTATTCCAAACAACAAAAACAAATTAAACTTCTAGTAATCTC
rJMSF020L04- AAATTAAACTTCTAGTAATCTC
                      ____________________________________________________________
consensus ATTTAAATGTGGTACTTGGTATTCCAAACAACAAAAACAAATTAAACTTCTAGTAATCTC
 
. : . : . : . : . : . :
rJMSF010A01- ACGTTAATAGAGAAATTAAATATATTGCCCTACTACGAGTGTCAAAATTAACTTGATGCC
rJMSF020L04- ACGTTAATAGAGAAATTAAATATATTGCCCTACTACGAGTGTCAAAATTAACTTGATGCC
                      ____________________________________________________________
consensus ACGTTAATAGAGAAATTAAATATATTGCCCTACTACGAGTGTCAAAATTAACTTGATGCC
 
. : . : . : . : . : . :
rJMSF010A01- GGTGTACTCTCCGGCTGCTGAACCGCGGCAACCTCCGCCGGAGAATCTTCTGGCGCCGGA
rJMSF020L04- GGTGTACTCTCCGGCTGCTGAACCGCGGCAACCTCCGCCGGAGAATCTTCTGGCGCCGGA
                      ____________________________________________________________
consensus GGTGTACTCTCCGGCTGCTGAACCGCGGCAACCTCCGCCGGAGAATCTTCTGGCGCCGGA
 
. : . : . : . : . : . :
rJMSF010A01- ACGGGGCTTTCCTCCGTTTGTAGAGACGTTTCAGCGCTTTCCACTGCTGGGACGGAGGCA
rJMSF020L04- ACGGGGCTTTCCTCCGTTTGTANAGACGTTTCAGCGCTTTCCACTGCTGGGACGGAGGCA
JMFN016H05+ ACGTTTCAGCGCTTTCCACTGCTGGGACGGAGGCA
                      ____________________________________________________________
consensus ACGGGGCTTTCCTCCGTTTGTAGAGACGTTTCAGCGCTTTCCACTGCTGGGACGGAGGCA
 
. : . : . : . : . : . :
rJMSF010A01- GCTTGGACCAATTCGTCGGCCTTGAACTTGTTGACGTAGTAGCTGAGCGAGGGGCCGGAG
rJMSF020L04- GCTTGGACCAATTCGTCGGCCTTGAACTTGTTGACGTAGTAGCTGAGCGAGGGGCCGGAG
JMFN016H05+ GCTTGGACCAATTCGTCGGCCTTGAACTTGTTGACGTAGTAGCTGAGCGAGGGGCCGGAG
JMFN007G02+ TCGTCGGCCTTGAACTTGTTGACGTAGTAGCTGAGCGAGGGGCCGAGA
JMSF020L04+ TTCGTCGGCCTTGAACTTGTTGACGTAGTAGCTGAGCGAGGGGCCGGAG
                      ____________________________________________________________
consensus GCTTGGACCAATTCGTCGGCCTTGAACTTGTTGACGTAGTAGCTGAGCGAGGGGCCGGAG
 
. : . : . : . : . : . :
rJMSF010A01- TATTCCGTCGCCGTCTGGATTGACGGAGGGGTGTTCTTCCCGACTTGGAGGAGAATGGAG
rJMSF020L04- TATTCCGTCGCCGTCTGGATTGACGGAGGGGTGTTCTTCCCGACTTGGAGGAAAATGGAG
JMFN016H05+ TATTCCGTCGCCGTCTGGATTGACGGAGGGGTGTTCTTCCCGACTTGGAGGAGAATGGAG
JMFN007G02+ TATTCCGTCGCCGTCTGGATTGACGGAGGGGTGTTCTTCCCGACTTGGAGGAGAATGGAG
JMSF020L04+ TATTCCGTCGCCGTCTGGATTGACGGAGGGGTGTTCTTCCCGACTTGGAGGAGAATGGAG
                      ____________________________________________________________
consensus TATTCCGTCGCCGTCTGGATTGACGGAGGGGTGTTCTTCCCGACTTGGAGGAGAATGGAG
 
. : . : . : . : . : . :
rJMSF010A01- GACGCGGCGGCGAGCGAGATGAGACCGATGCCGGCGGCGATGGCAAGGTTGTTGTCGGAT
rJMSF020L04- GACGCGGCGGCGAGCGAGATGAGACCGATGCCGGCGGCGATGGCAAGGTTGTTGTCGGAT
JMFN016H05+ GACGCGGCGGCGAGCGAGATGAGACCGATGCCGGCGGCGATGGCAAGGTTGTTGTCGGAT
JMFN010D12+ ATGAGACCGATGCCGGCGGCGATGGCAAGGTTGTTGTCGGAT
JMFN007G02+ GACGCGGCGGCGAGCGAGATGAGACCGATGCCGGCGGCGATGGCAAGGTTGTTGTCGGAT
JMSF020L04+ GACGCGGCGGCGAGCGAGATGAGACCGATGCCGGCGGCGATGGCAAGGTTGTTGTCGGAT
                      ____________________________________________________________
consensus GACGCGGCGGCGAGCGAGATGAGACCGATGCCGGCGGCGATGGCAAGGTTGTTGTCGGAT
 
. : . : . : . : . : . :
rJMSF010A01- CCGTCGGAAGAG-GAACCCGCGGTTCCGGAGCTGAAAGCGGTCTCGGCCACGTACACCGC
rJMSF020L04- CCGTCGGAAGAG-GAACCCGNGGTTCCGGAGCTGAAAGCGGTCTCGGCCACGTACACCGC
JMFN016H05+ CCGTCGGAAGAG-GAACCCGCGGTTCCGGAGCTGAAAGCGGTCTCGGCCACGTACACCGC
JMFN010D12+ CCGTCGTAAGAGAGAACCCGCGGTTCCGGAGCTGAAAGCGGTCTCGGCCACGTACACCGC
JMFN007G02+ CCGTCGGAAGAG-GAACCCGCGGTTCCGGAGCTGAAAGCGGTCTCGGCCACGTACACCGC
JMSF020L04+ CCGTCGGAAGAG-GAACCCGCGGTTCCGGAGCTGAAAGCGGTCTCGGCCACGTACACCGC
                      ____________________________________________________________
consensus CCGTCGGAAGAG-GAACCCGCGGTTCCGGAGCTGAAAGCGGTCTCGGCCACGTACACCGC
 
. : . : . : . : . : . :
rJMSF010A01- GGGTTCGACGGAGTAGATGTTGGTCTGCCCTGCGGTGTCCTTCTCAACGTACCCAGTCCA
rJMSF020L04- GGGTTCGACGGAGTANATGTTGGTCTGCCCTGCGGTGTCCTTCTCAACGTACCCAGTCCA
JMFN016H05+ GGGTTCGACGGAGTAGATGTTGGTCTGCCCTGCGGTGTCCTTCTCAACGTACCCAGTCCA
JMFN010D12+ GGGTTCGACGGAGTAGATGTTGGTCTGCCCTGCGGTGTCCTTCTCAACGTACCCAGTCCA
JMFN007G02+ GGGTTCGACGGAGTAGATGTTGGTCTGCCCTGCGGTGTCCTTCTCAACGTACCCAGTCCA
JMSF020L04+ GGGTTCGACGGAGTAGATGTTGGTCTGCCCTGCGGTGTCCTTCTCAACGTACCCAGTCCA
                      ____________________________________________________________
consensus GGGTTCGACGGAGTAGATGTTGGTCTGCCCTGCGGTGTCCTTCTCAACGTACCCAGTCCA
 
. : . : . : . : . : . :
rJMSF010A01- GCCGCTCTTCCGGGCCATCGGCGGGAACGTTCCGACCACCTTCGTTTTTTCCTCGGCTAC
rJMSF020L04- GCCGCTCTTCCGGGCCATCGGCGGGAACGTTCCGACCACCTTCGTTTTTTCCTCGGCTAC
JMFN016H05+ GCCGCTCTTCCGGGCCATCGGCGGGAACGTTCCGACCACCTTCGTTTTTTCCTCGGCTAC
JMFN010D12+ GCCGCTCTTCCGGGCCATCGGCGGGAACGTTCCGACCACCTTCGTTTTTTCCTCGGCTAC
JMFN007G02+ GCCGCTCTTCCGGGCCATCGGCGGGAACGTTCCGACCACCTTCGTTTTTTCCTCGGCTAC
JMSF020L04+ GCCGCTCTTCCGGGCCATCGGCGGGAACGTTCCGACCACCTTCGTTTTTTCCTCGGCTAC
                      ____________________________________________________________
consensus GCCGCTCTTCCGGGCCATCGGCGGGAACGTTCCGACCACCTTCGTTTTTTCCTCGGCTAC
 
. : . : . : . : . : . :
rJMSF010A01- CCACTCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
rJMSF020L04- CCACTCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
JMFN016H05+ CCACTCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
JMFN010D12+ CCACTCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
JMFN007G02+ CCACTCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
JMSF020L04+ CCACTCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
JMSF010A01+ TCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
                      ____________________________________________________________
consensus CCACTCCATGCTCACCTGCCCCACCTCCTTCTCCGGTGCGCATTCCTCCGCATTGCAGTC
 
. : . : . : . : . : . :
rJMSF010A01- GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTCTTCTCATTCTACCACTACACCTGAA
rJMSF020L04- GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTCTTCTCATTCTACCACTACACCTGAA
JMFN016H05+ GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTCTTCTCATTCTACCACTACACCTGAA
JMFN010D12+ GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTATTCTCATTCTACCACTACACCTGAA
JMFN007G02+ GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTCTTCTCATTCTACCACTACACCTGAA
JMSF020L04+ GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTCTTCTCATTCTACCACTACACCTGAA
JMSF010A01+ GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTCTTCTCATTCTACCACTACACCTGAA
                      ____________________________________________________________
consensus GGAATCTGAAGAATTTGCTCGGACGATCAGCTCTCTTCTCATTCTACCACTACACCTGAA
 
. : . : . : . : . : . :
rJMSF010A01- CCCATTCCTCTTCGTCTGGCACTTCCGCAA
rJMSF020L04- CCCATTCCTCTTCGTCTGGCACTTCCGCAAGAACAACAACCCGCCGCCGCTGGNAGCGCC
JMFN016H05+ CCCATTCCTCTTCGTCTGGCACTTCCGCAAGAACAACAACCCGCCGCCGCTGGCAGCGCC
JMFN010D12+ CCCATTCCTCTTCGTATGGCACTTCCGCAAGAACAACAACCCGCCGCCGCTGGCAGCGCC
JMFN007G02+ CCCATTCCTCTTCGTCTGGCACTTCCGCAAGAACAACAACCCGCCGCCGCTGGCAGCGCC
JMSF020L04+ CCCATTCCTCTTCGTCTGGCACTTCCGCAAGAACAACAACCCGCCGCCGCTGGCAGCGCC
JMSF010A01+ CCCATTCCTCTTCGTCTGGCACTTCCGCAAGAACAACAACCCGCCGCCGCTGGCAGCGCC
                      ____________________________________________________________
consensus CCCATTCCTCTTCGTCTGGCACTTCCGCAAGAACAACAACCCGCCGCCGCTGGCAGCGCC
 
. : . : . : . : . : . :
rJMSF020L04- GGTAGCCGGCG
JMFN016H05+ GGTAGCCGGCGAGGCAATCTTGAAGGTGGTTCCCCATACAAC
JMFN010D12+ GGTAGCCGGCGAGGCAATCTTGAAGGTGGTTCCCCATACAACACAAGCAGC
JMFN007G02+ GGTAGCCGGCGAGGCAATCTTGAAGGTGGTTCCCCATACAACACAAGCAGCCATGCCTCC
JMSF020L04+ GGTAGCCGGCGAGGCAATCTTGAAGGTGGTTCCCCATACAACACAAGCAGCCATGCCTCC
JMSF010A01+ GGTAGCCGGCGAGGCAATCTTGAAGGTGGTTCCCCATACAACACAAGCAGCCATGCCTCC
                      ____________________________________________________________
consensus GGTAGCCGGCGAGGCAATCTTGAAGGTGGTTCCCCATACAACACAAGCAGCCATGCCTCC
 
. : . : . : . : . : . :
JMFN007G02+ TCTCTCGATCTATCTC
JMSF020L04+ TCTCTCGATCTATCTCTCTCTCACTCCCTGACAGTTGATTTGTATTGAATCAGAACCG
JMSF010A01+ TCTCTCGATCTATCTCTCTCTCACTCCCTGACAGTTGATTTGTATTGAATCAGAACCGCC
                      ____________________________________________________________
consensus TCTCTCGATCTATCTCTCTCTCACTCCCTGACAGTTGATTTGTATTGAATCAGAACCGCC