Previous Contig 005108:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS109F08Sequence419005108 (2)
JMSF009M13Sequence333005108 (2)759022338gb:AF230198_17790133e-30Lycopersicon esculentum putative protein kinase LESK1 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS109F08+ AGAGTTAATCCTCCCATTCA
                      ____________________________________________________________
consensus AGAGTTAATCCTCCCATTCA
 
. : . : . : . : . : . :
JMFS109F08+ TTTTGCTAACCAAATGCATGTAAACGAGAAAATCGTAAGAATTATTTGAAATATTAAAAT
                      ____________________________________________________________
consensus TTTTGCTAACCAAATGCATGTAAACGAGAAAATCGTAAGAATTATTTGAAATATTAAAAT
 
. : . : . : . : . : . :
JMFS109F08+ AAAATGAATATGTATACTACATTTCTGTCACCCGGCAAACATCTTTATCGAGACTGCAGT
JMSF009M13+ TCACCCGGCAAACATCTTTATCGAGACTGCAGT
                      ____________________________________________________________
consensus AAAATGAATATGTATACTACATTTCTGTCACCCGGCAAACATCTTTATCGAGACTGCAGT
 
. : . : . : . : . : . :
JMFS109F08+ CGCAAGTAACGCTATCTTCAAGTTCTATGAAACAATGCGAGTTATGACGATAAGTCCTCG
JMSF009M13+ CGCAAGTAACGCTATCTTCAAGTTCTATGAAACAATGCGAGTTATGACGATAAGTCCTCG
                      ____________________________________________________________
consensus CGCAAGTAACGCTATCTTCAAGTTCTATGAAACAATGCGAGTTATGACGATAAGTCCTCG
 
. : . : . : . : . : . :
JMFS109F08+ TCTGACATCCAAGCAATTCAATAATGGCTTTCTCATCTTCGGTGCCAAGAGGTTTGCTTT
JMSF009M13+ TCTGACATCCAAGCAATTCAATAATGGCTTTCTCATCTTCGGTGCCAAGAGGTTTGCTTT
                      ____________________________________________________________
consensus TCTGACATCCAAGCAATTCAATAATGGCTTTCTCATCTTCGGTGCCAAGAGGTTTGCTTT
 
. : . : . : . : . : . :
JMFS109F08+ GGTTGTCAGCAAGGTTGAGTATCTTAGTGCAGATTTTTGAAATAGGTCCTGTTGTTGTTA
JMSF009M13+ GGTTGTCAGCAAGGTTGAGTATCTTAGTGCAGATTTTTGAAATAGGTCCTGTTGTTGTTA
                      ____________________________________________________________
consensus GGTTGTCAGCAAGGTTGAGTATCTTAGTGCAGATTTTTGAAATAGGTCCTGTTGTTGTTA
 
. : . : . : . : . : . :
JMFS109F08+ CAGTTCCTTCTCCCATGGTTAGTTGAGAGTTGAGAGAGAAGAGCAGCAATAATAATATCA
JMSF009M13+ CAGTTCCTTCTCCCATGGTTAGTTGAGAGTTGAGAGAGAAGAGCAGCAATAATAATATCA
                      ____________________________________________________________
consensus CAGTTCCTTCTCCCATGGTTAGTTGAGAGTTGAGAGAGAAGAGCAGCAATAATAATATCA
 
. : . : . : . : . : . :
JMFS109F08+ TCTTTTCCATCTCTCAATAATTGAGTTGATTCAATTCTC
JMSF009M13+ TCTTTTCCATCTCTCAATAATTGAGTTGATTCAATTCTCTGATTTGTTTGGTATCTCTTC
                      ____________________________________________________________
consensus TCTTTTCCATCTCTCAATAATTGAGTTGATTCAATTCTCTGATTTGTTTGGTATCTCTTC