Previous Contig 005097:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009K19Sequence288005097 (2)gb:AF506028_18068502e-16Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen741011981 (2)gb:AF506028_18068506e-71Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen
JMSF017N14Sequence216005097 (2)gb:AP004013_18363702e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ15711011981 (2)gb:AF506028_18068504e-46Poncirus trifoliata citrus tristeza virus resistance gene locus, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF009K19+ CAAGCATGGTGAGCTGCTGCTGACTGAAACCCAGAACTGATTTCAGAG
                      ____________________________________________________________
consensus CAAGCATGGTGAGCTGCTGCTGACTGAAACCCAGAACTGATTTCAGAG
 
. : . : . : . : . : . :
JMSF017N14+ GTAAGCATTTCCTGCTGCTATTTGCATCCAAACTGAGG
JMSF009K19+ TGTGGGAATAGAGTGGGAAATTGTAAGCATTTCCTGCTGCTATTTGCATCCAAACTGAGG
                      ____________________________________________________________
consensus TGTGGGAATAGAGTGGGAAATTGTAAGCATTTCCTGCTGCTATTTGCATCCAAACTGAGG
 
. : . : . : . : . : . :
JMSF017N14+ CCCCAAGACCCACCCATGGTGGCCTTGTCCCTCCCTTCAAGTTCACCATTCTTGAGACCC
JMSF009K19+ CCCCAAGACCCACCCATGGTGGCCTTGTCCCTCCCTTCAAGTTCACCATTCTTGAGACCC
                      ____________________________________________________________
consensus CCCCAAGACCCACCCATGGTGGCCTTGTCCCTCCCTTCAAGTTCACCATTCTTGAGACCC
 
. : . : . : . : . : . :
JMSF017N14+ TTTGTTTAGCTCTCAAGAATCAGGGGATAGCAGAGGAAAGAGTGGGTTTTGATCT-ATTT
JMSF009K19+ TTTGTTTAGCTCTCAAGAATCAGGGGATAGCAGAGGAAAGAGTGGGTTTTGATCTGATTT
                      ____________________________________________________________
consensus TTTGTTTAGCTCTCAAGAATCAGGGGATAGCAGAGGAAAGAGTGGGTTTTGATCTGATTT
 
. : . : . : . : . : . :
JMSF017N14+ GGTTTTGCAGGGAGGGGGGAAGAATTGAGGAAAGGAGTGTGAAAGTGAGAGATTGTGTC
JMSF009K19+ GGTTTTGCAGGGAGGGGGGAAGAATTGAGGAAAGGAGTGTGAAAGTGAGAGATTGTGTCC
                      ____________________________________________________________
consensus GGTTTTGCAGGGAGGGGGGAAGAATTGAGGAAAGGAGTGTGAAAGTGAGAGATTGTGTCC