Previous Contig 005092:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015B22Sequence588005092 (30)pir|T51527|T515278e-87UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498540005092 (30)sp|Q96558|UGDH_SOYBN5e-50UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (U
JMFF016B02Sequence583005092 (30)pir|T51527|T515274e-86UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498728005092 (30)gb:AY619949_16183193e-85Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.
JMFF016B08Sequence542005092 (30)pir|T51527|T515271e-77UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498
JMFF018F11Sequence575005092 (30)pir|T51527|T515273e-84UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498729005092 (30)gb:AY619949_16183193e-85Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.
JMFF021I02Sequence559005092 (30)pir|T51527|T515275e-82UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498717005092 (30)gb:AP001309_18211283e-72Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUO10.
JMFF022G03Sequence451005092 (30)pir|T51527|T515278e-62UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498711005092 (30)gb:AY619949_16183198e-70Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.
JMFF022H03Sequence484005092 (30)pir|T51527|T515279e-68UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498731005092 (30)gb:AY619949_16183192e-85Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.
JMFF032E14Sequence321005092 (30)gb:AY466400_16080359e-21Populus tomentosa UDP-glucose dehydrogenase (ugdh) mRNA, complete cds.
JMFF051L24Sequence592005092 (30)pir|T51527|T515271e-84UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498480005092 (30)sp|Q96558|UGDH_SOYBN4e-36UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (U
JMFN018L05Sequence607005092 (30)gb:AF053973_1764484e-101Populus tremula x Populus tremuloides UDP-glucose dehydrogenase gene (ugdh), com
JMFS089D01Sequence433005092 (30)gb:AY466400_16080356e-28Populus tomentosa UDP-glucose dehydrogenase (ugdh) mRNA, complete cds.
JMFS089D08Sequence433005092 (30)gb:AY466400_16080356e-28Populus tomentosa UDP-glucose dehydrogenase (ugdh) mRNA, complete cds.
JMFS154A03Sequence640005092 (30)gb:AF053973_1764484e-104Populus tremula x Populus tremuloides UDP-glucose dehydrogenase gene (ugdh), com
JMSF009K04Sequence371005092 (30)pir|T51527|T515273e-47UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498659005092 (30)sp|Q96558|UGDH_SOYBN9e-70UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (U
JMSF010F03Sequence352005092 (30)gb:BT006380_16392673e-44Arabidopsis thaliana At5g39320 gene, complete cds.730005092 (30)gb:AY619949_16183191e-89Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.
JMSF011K19Sequence291005092 (30)gb:BT006380_16392673e-34Arabidopsis thaliana At5g39320 gene, complete cds.687005092 (30)gb:AY619949_16183198e-83Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.
JMSF019O12Sequence488005092 (30)pir|T51527|T515274e-67UDP-glucose dehydrogenase-like protein - Arabidopsis thaliana>gb:ATT20K14_155498765005092 (30)gb:AY619949_16183193e-97Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.
JMSF047G13Sequence719005092 (30)gb:AF503433_1806744e-110Sorghum bicolor BAC 170F8, complete sequence.769005092 (30)gb:AY619949_16183191e-93Nicotiana tabacum putative UDP-glucose dehydrogenase 2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS089D08+ AGAAGTAATAGCCTCATATAAATTCAAAGTAACGAATCA
JMFS089D01+ AGAAGTAATAGCCTCATATAAATTCAAAGTAACGAATCA
rJMFF051L24- AGAAGTAATAGCCTCATATAAATTCAAAGTAACGAATCA
rJMFF015B22- AAGTAACGAATCA
rJMFF021I02- TAGCCTCATATAAATTCAAAGTAACGAATCA
rJMFF022G03- AGTAACGAATCA
rJMFF016B02- AAGTAACGAATCA
rJMFF018F11- AAGTAACGAATCA
rJMFF022H03- AAGTAACGAATCA
                      ____________________________________________________________
consensus AGAAGTAATAGCCTCATATAAATTCAAAGTAACGAATCA
 
. : . : . : . : . : . :
JMFS089D08+ GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
JMFS089D01+ GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMFF051L24- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMFF015B22- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMFF021I02- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMFF022G03- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMSF011K19- AAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMSF009K04- GGTCCCTTACGTAAGAGAAGTAAACAA-TANAAAGGAATGGTATCATCNATACACACAAG
rJMFF016B02- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMFF018F11- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMFF022H03- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMSF010F03- TAAGAGAAGTAAACAATTAAAAAGGAATGGTATCATCAATACACACAAG
rJMSF047G13- GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
rJMSF019O12- TAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
                      ____________________________________________________________
consensus GGTCCCTTACATAAGAGAAGTAAACAA-TAAAAAGGAATGGTATCATCAATACACACAA-
 
. : . : . : . : . : . :
JMFS089D08+ GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF032E14- AAACCTACTNGCTTTAACCCGAG-TAGCAACAATGATGATCCACGGGCATACGTA
JMFS089D01+ GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF051L24- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF015B22- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF021I02- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF022G03- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMSF011K19- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMSF009K04- ATAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF016B02- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF018F11- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMFF022H03- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMSF010F03- GTAAAAAACCTACTTGCTTTAACCCAAGCTAGCAACAATGATGATCCACGGG-ATACG-A
rJMSF047G13- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
rJMSF019O12- GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
                      ____________________________________________________________
consensus GTAAAAAACCTACTTGCTTTAACCCAAG-TAGCAACAATGATGATCCACGGG-ATACG-A
 
. : . : . : . : . : . :
JMFS089D08+ AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF032E14- AACTGGGAACGTTATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGNTACT
JMFS089D01+ AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF051L24- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF015B22- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF021I02- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF022G03- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMSF011K19- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMSF009K04- AACTGGGAACG-TATAAACNCGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF016B02- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF018F11- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMFF022H03- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMSF010F03- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMSF047G13- AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
rJMSF019O12- AACTAGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
                      ____________________________________________________________
consensus AACTGGGAACG-TATAAACACGCTAAAGGCTAAAGAATCCCGGGTGATGGAATCGTTACT
 
. : . : . : . : . : . :
JMFS089D08+ GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF032E14- GTGATGTTCGGTTCAACAATGNGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
JMFS089D01+ GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF051L24- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF015B22- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF021I02- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF022G03- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMSF011K19- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMSF009K04- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF016B02- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF018F11- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMFF022H03- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMSF010F03- GTGATGTTCGGTTCAACAATGTGTGGGCGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMSF047G13- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
rJMSF019O12- GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
                      ____________________________________________________________
consensus GTGATGTTCGGTTCAACAATGTGTGGGTGATGTTCAAGCGACAGCCGGCATGTCCTTGAG
 
. : . : . : . : . : . :
JMFS089D08+ CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF032E14- CCAGGGATCGAGCGGCTTACCTATANAGTAGACAATGAACCCGATCTCNCTCAACTTCTC
JMFS089D01+ CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF051L24- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF015B22- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF021I02- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF022G03- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMSF011K19- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMSF009K04- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF016B02- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF018F11- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMFF022H03- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTCCTC
rJMSF010F03- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMSF047G13- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
rJMSF019O12- CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
                      ____________________________________________________________
consensus CCAGGGATCGAGCGGCTTACCTATAGAGTAGACAATGAACCCGATCTCTCTCAGCTTCTC
 
. : . : . : . : . : . :
JMFS089D08+ TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF032E14- TGCATTGANCACGTTCCTACCATCGAAGACAAAAGCGGNTTTCTGCATGCTATCGTATAT
JMFS089D01+ TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF051L24- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF015B22- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF021I02- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF022G03- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMSF011K19- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMSF009K04- TGCNTTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF016B02- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF018F11- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMFF022H03- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMSF010F03- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMSF047G13- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
rJMSF019O12- TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
                      ____________________________________________________________
consensus TGCATTGATCACGTTCCTACCATCGAAGACAAAAGCGGGTTTCTGCATGCTATCGTATAT
 
. : . : . : . : . : . :
JMFS089D08+ CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTG
rJMFF032E14- CTTTTTGTATNCGAGAGNCTTGAACTC
JMFS089D01+ CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTG
rJMFF051L24- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMFF015B22- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMFF021I02- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMFF022G03- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMSF011K19- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMSF009K04- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAAAGGGCATGAGC
rJMFF016B02- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMFF018F11- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMFF022H03- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMSF010F03- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMSF047G13- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
rJMSF019O12- CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
                      ____________________________________________________________
consensus CTTTTTGTAGTCGAGAGTCTTGAACTCGTCCCACTCGGTGAGAATGCAGAGGGCATGAGC
 
. : . : . : . : . : . :
rJMFF051L24- GTCCTTTGCCGCTGAGTATGCATCCCA
rJMFF015B22- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGNGGTGGGGCT
rJMFF021I02- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMFF022G03- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMSF011K19- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMSF009K04- GTCCTTTGCCNCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGNTGGGGCT
rJMFF016B02- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMFF018F11- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMFF022H03- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMSF010F03- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMSF047G13- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
rJMSF019O12- GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
                      ____________________________________________________________
consensus GTCCTTTGCCGCTGAGTATGCATCCCAAACGACGGAAACTTGTTTCACCGTGGTGGGGCT
 
. : . : . : . : . : . :
rJMFF015B22- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGT
rJMFF021I02- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMFF022G03- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMSF011K19- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMSF009K04- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCNAATTTTTTCATTGTGAGGTCCCTTTG
rJMFF016B02- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMFF018F11- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMFF022H03- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMSF010F03- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMSF047G13- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
rJMSF019O12- CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
JMFN018L05+ GTGAGGTCCCTTTG
                      ____________________________________________________________
consensus CATTGGTTGGAGATGGCGGGGGTGATCCCAGTCGAATTTTTTCATTGTGAGGTCCCTTTG
 
. : . : . : . : . : . :
rJMFF021I02- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMFF022G03- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMSF011K19- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMSF009K04- GATTTGGNCCTCGNTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAGTAG
rJMFF016B02- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMFF018F11- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMFF022H03- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMSF010F03- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMSF047G13- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
rJMSF019O12- GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
JMFN018L05+ GATTTGGTCCTCGTT-ACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCNCAATAG
                      ____________________________________________________________
consensus GATTTGGTCCTCGTTAACTTGAGGGTCGTATATGCTTAAAAGGGCCTTGTCCCCCAATAG
 
. : . : . : . : . : . :
rJMFF021I02- ACCCTTGCAAACATCGATAGCCGGGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
rJMFF022G03- ACCCTTGCAAACATCGATAGCC-GGGGTCTCACGGGGTATCACCGGTGTCCTTTTTGAAA
rJMSF011K19- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
rJMSF009K04- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTT
rJMFF016B02- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
rJMFF018F11- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
rJMFF022H03- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
rJMSF010F03- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
rJMSF047G13- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
rJMSF019O12- ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
JMFN018L05+ ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
                      ____________________________________________________________
consensus ACCCTTGCAAACATCGATAGCC-GGGGTCTCAC-GGGTATCACCGGTGTCCTTTTTGAAA
 
. : . : . : . : . : . :
rJMFF021I02- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAG
rJMFF022G03- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACA
rJMSF011K19- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACAT
rJMFF016B02- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
rJMFF018F11- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
rJMFF022H03- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
rJMSF010F03- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
rJMSF047G13- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
rJMSF019O12- GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
JMFN018L05+ GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
JMFS154A03+ CGAACCCCAAAATGGCAAC-TTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
                      ____________________________________________________________
consensus GCGAACCCCAAAATGGCAACTTTCTTGCTCGAGACCGTGTTGAACATGGATGCAACAACA
 
. : . : . : . : . : . :
rJMFF016B02- CGG
rJMFF018F11- CGGT
rJMFF022H03- CGGTTG
rJMSF010F03- CGGTTGACGAACCGGTTCTTTTGGTA
rJMSF047G13- CGGTTGACGAACCGGTTCTTTTGGTAATCGTTGATCTTGATTACTTGCT
rJMSF019O12- CGGTTGACGAACCGGTTCTTTTGGTAATCGTTGATCTTGATTACTTGCT
JMFN018L05+ CGGTTGACGAACCGGTTCTTTTGGTAATCGTTGATCTTGATTACTTGCTTCCAGTACTCA
JMFS154A03+ CGGTTGACGAACCGGTTCTTTTGGTAATCGTTGATCTTGATTACTTGCTTCCAGTACTCA
                      ____________________________________________________________
consensus CGGTTGACGAACCGGTTCTTTTGGTAATCGTTGATCTTGATTACTTGCTTCCAGTACTCA
 
. : . : . : . : . : . :
JMFN018L05+ GCCACCTCGGGAAGGCCATTGCACTCGCAAATGTAAACCAGGTTAAGAATATCCTTCTGA
JMFS154A03+ GCCACCTCGGGAAGGCCATTGCACTCGCAAATGTAAACCAGGTTAAGAATATCCTTCTGA
                      ____________________________________________________________
consensus GCCACCTCGGGAAGGCCATTGCACTCGCAAATGTAAACCAGGTTAAGAATATCCTTCTGA
 
. : . : . : . : . : . :
JMFN018L05+ AAGCAAGAACCACCGAAACCAACACTAGCGTTCAAGAACTTGGGACCGATTCTCGTGTCC
JMFS154A03+ AAGCAAGAACCACCGAAACCAACACTAGCGTTCAAGAACTTGGGACCGATTCTCGTGTCC
                      ____________________________________________________________
consensus AAGCAAGAACCACCGAAACCAACACTAGCGTTCAAGAACTTGGGACCGATTCTCGTGTCC
 
. : . : . : . : . : . :
JMFN018L05+ TTACCAACGGCATATGACACCTCGGTAACATCTGCTCCAGTAGCCTCGCACAGAGCTGAC
JMFS154A03+ TTACCAACGGCATATGACACCTCGGTAACATCTGCTCCAGTAGCCTCGCACAGAGCTGAC
                      ____________________________________________________________
consensus TTACCAACGGCATATGACACCTCGGTAACATCTGCTCCAGTAGCCTCGCACAGAGCTGAC
 
. : . : . : . : . : . :
JMFN018L05+ ATGGCATTCACCGAGGATATCCTTTGTGCTAGGAAGGCATTGGCAGCCAACTTTGAGAGC
JMFS154A03+ ATGGCATTCACCGAGGATATCCTTTGTGCTAGGAAGGCATTGGCAGCCAACTTTGAGAGC
                      ____________________________________________________________
consensus ATGGCATTCACCGAGGATATCCTTTGTGCTAGGAAGGCATTGGCAGCCAACTTTGAGAGC
 
. : . : . : . : . : . :
JMFN018L05+ TCGGCAGACCACAAGTTGGTGGTGAGGATGCGATCTACGGGGACCCAGTGAGCATACACA
JMFS154A03+ TCGGCAGACCACAAGTTGGTGGTGAGGATGCGATCTACGGGGACCCAGTGAGCAT--AGA
JMSF047G13+ CGGCAGACCACAAGTTGGTGGTGAGGATGCGATCTACGGGGACCCAGTGAGCATACACA
                      ____________________________________________________________
consensus TCGGCAGACCACAAGTTGGTGGTGAGGATGCGATCTACGGGGACCCAGTGAGCATACACA
 
. : . : . : . : . : . :
JMFN018L05+ TCCTTGAGTGCCTTGACTGCCTTGTTGCCTTCTGGGGTCTCCCGACCTCCAAT
JMFS154A03+ TCCTTGAGTGCCTTGACTGCCTTGTTGCCTTCTGGGGTCTCCCGACCTCCAATAAGGACT
JMSF047G13+ TCCTTGAGTGCCTTGACTGCCTTGTTGCCTTCTGGGGTCTCCCGACCTCCAATAAGGACT
                      ____________________________________________________________
consensus TCCTTGAGTGCCTTGACTGCCTTGTTGCCTTCTGGGGTCTCCCGACCTCCAATAAGGACT
 
. : . : . : . : . : . :
JMFS154A03+ CTATCCGGTTGAAAGAGATCTTGGATTGCAGTTCCCTCGGCAAGAAACTCAGGGTTCGAG
JMFF016B02+ AAGAGATCTTGGATTGCAGTTCCCTCGGCAAGAAACTCAGGGTTCGAG
JMFF021I02+ TCGGCAAGAAACTCAGGGTTCGAG
JMFF051L24+ GCAGTTCCCTCGGCAAGAAACTCAGGGTTCGAG
JMFF016B08+ GAG
JMFF015B22+ AAGAGATCTTGGATTGCAGTTCCCTCGGCAAGAAACTCAGGGTTCGAG
JMSF047G13+ CTATCCGGTTGAAAGAGATCTTGGATTGCAGTTCCCTCGGCAAGAAACTCAGGGTTCGAG
JMFF018F11+ ATTGCAGTTCCCTCGGCAAGAAACTCAGGGTTCGAG
                      ____________________________________________________________
consensus CTATCCGGTTGAAAGAGATCTTGGATTGCAGTTCCCTCGGCAAGAAACTCAGGGTTCGAG
 
. : . : . : . : . : . :
JMFS154A03+ AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCCTCAGCG
JMFF016B02+ AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCCTCAGCG
JMFF021I02+ AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCCTCAGCG
JMFF051L24+ AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTCTCNAATAGCCTCAGCG
JMFF016B08+ AGGATNTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCNTCAGCG
JMFF015B22+ AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCCTCAGCG
JMSF047G13+ AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCCTCAGCG
JMFF022H03+ CAGCG
JMFF018F11+ AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCCTCAGCG
JMSF019O12+ TCAGCG
                      ____________________________________________________________
consensus AGGATCTGAAAATTAATTCCCTTGCTGTTGTGGGTCAGAATTTTCTCAATAGCCTCAGCG
 
. : . : . : . : . : . :
JMFS154A03+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGA
JMFF016B02+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
JMFF021I02+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
JMFF051L24+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
JMFF016B08+ GTTTTGACTGGAACAGTNGATTTCTCAACCACGATTTTGTCAGATTTNGAAACATCAGCA
JMFF015B22+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
JMSF047G13+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
JMFF022H03+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
JMFF022G03+ CCACGATTTTGTCAGATTTCGAAACATCAGCA
JMFF018F11+ GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
JMSF019O12+ GTTTNGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
                      ____________________________________________________________
consensus GTTTTGACTGGAACAGTCGATTTCTCAACCACGATTTTGTCAGATTTCGAAACATCAGCA
 
. : . : . : . : . : . :
JMFF016B02+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMFF021I02+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMFF051L24+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMFF016B08+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMFF015B22+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMSF047G13+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMFF022H03+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMFF022G03+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMFF018F11+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMSF019O12+ ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
JMSF009K04+ CTCCGAGTCCC
                      ____________________________________________________________
consensus ATCATGCGAGCAGCACTCTCCCAATACGTCAAATCTGCAGCTTTCCCAGCTCCGAGTCCC
 
. : . : . : . : . : . :
JMFF016B02+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMFF021I02+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMFF051L24+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMFF016B08+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMFF015B22+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMSF010F03+ CGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMSF047G13+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMFF022H03+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMFF022G03+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMFF018F11+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMSF019O12+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
JMSF009K04+ GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
                      ____________________________________________________________
consensus GTGGTCTTCGTAGGAGTGTTGACAGAAACAAAGACTATATCGGCCTCGCATACATGTTTC
 
. : . : . : . : . : . :
JMFF016B02+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMFF021I02+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMFF051L24+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMFF016B08+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMSF011K19+ ACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMFF015B22+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMSF010F03+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMSF047G13+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMFF022H03+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMFF022G03+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMFF018F11+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMSF019O12+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
JMSF009K04+ TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
                      ____________________________________________________________
consensus TCCACATCAGTGCTGAAGATGAGGTTTTTCCCTCGGCACTGCTTCACTACATCATCAAGA
 
. : . : . : . : . : . :
JMFF016B02+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMFF021I02+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMFF051L24+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMFF016B08+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMSF011K19+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMFF015B22+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMSF010F03+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMSF047G13+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMFF022H03+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMFF022G03+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMFF018F11+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMSF019O12+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
JMSF009K04+ CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
                      ____________________________________________________________
consensus CCCGGCTCATAGATCGGGAGCTGGTCACTGTTCCAGGCATTGATCCGAGGCACGGAGATA
 
. : . : . : . : . : . :
JMFF016B02+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMFF021I02+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMFF051L24+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMFF016B08+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMSF011K19+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMFF015B22+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMSF010F03+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMSF047G13+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMFF022H03+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMFF022G03+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMFF018F11+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMSF019O12+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
JMSF009K04+ TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
                      ____________________________________________________________
consensus TCAACCACAGCCACTTGAATGTTCGGGCACTTGAGTGCTATCACCGCCATCGTGGGCCCC
 
. : . : . : . : . : . :
JMFF016B02+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMFF021I02+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMFF051L24+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMFF016B08+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMSF011K19+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMFF015B22+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMSF010F03+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMSF047G13+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMFF022H03+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMFF022G03+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMFF018F11+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMSF019O12+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
JMSF009K04+ CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
                      ____________________________________________________________
consensus CCAACATATCCCGCACCAATACAGCAAATCTTTACCATCTTTGCTCAAATGAATCGCTCT
 
. : . : . : . : . : . :
JMFF016B02+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTAT
JMFF021I02+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTAT
JMFF051L24+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTAT
JMFF016B08+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTAT
JMSF011K19+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGT
JMFF015B22+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATG
JMSF010F03+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATA
JMSF047G13+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATGTA
JMFF022H03+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATGTAT
JMFF022G03+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATGTAT
JMFF018F11+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATGTAT
JMSF019O12+ CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATGTAT
JMSF009K04+ CGTAAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATGTATC
                      ____________________________________________________________
consensus CGTCAAAGGCGCCGCGAAGAACAGAAGAAATGTTCTGCAACACCGGGTAGTGTATGTATC