Previous Contig 005091:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003K16Sequence257005091 (7)716009624 (6)gb:OSJN00138_16955182e-31Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFF030C10Sequence563005091 (7)gb:AY484589_16083321e-42Musa acuminata clone MuH9, genomic sequence.738009624 (6)gb:OSJN00138_16955181e-05Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFF036I03Sequence557005091 (7)gb:AY484589_16083323e-43Musa acuminata clone MuH9, genomic sequence.727009624 (6)gb:OSJN00138_16955184e-33Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFF037E22Sequence626005091 (7)gb:AY484589_16083321e-59Musa acuminata clone MuH9, genomic sequence.743009624 (6)gb:OSJN00138_16955182e-35Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc
JMFS107B09Sequence627005091 (7)gb:AY484589_16083322e-64Musa acuminata clone MuH9, genomic sequence.
JMFS111E08Sequence642005091 (7)gb:AY484589_16083329e-37Musa acuminata clone MuH9, genomic sequence.
JMSF009K03Sequence371005091 (7)gb:AY484589_16083320.004Musa acuminata clone MuH9, genomic sequence.767009624 (6)gb:OSJN00138_16955185e-41Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ990528_30, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS107B09+ AAGCACCC
                      ____________________________________________________________
consensus AAGCACCC
 
. : . : . : . : . : . :
JMFS107B09+ AGGGCCATCATTGATGGATGTGCTAATATAAGCTCTCCAGCAAGTAGTACAAAAGGGATG
JMFF037E22+ GCTAATATAAGCTCTCCAGCAAGTAGTACAAAAGGGATG
                      ____________________________________________________________
consensus AGGGCCATCATTGATGGATGTGCTAATATAAGCTCTCCAGCAAGTAGTACAAAAGGGATG
 
. : . : . : . : . : . :
JMFS107B09+ ACCACATGCAGCAGTAACCAGCACATGAGAAGGATAGTTATCAAAGCATATGCCACACAC
JMFF037E22+ ACCACATGCAGCAGTAACCAGCACATGAGAAGGATAGTTATCAAAGCATATGCCACACAC
                      ____________________________________________________________
consensus ACCACATGCAGCAGTAACCAGCACATGAGAAGGATAGTTATCAAAGCATATGCCACACAC
 
. : . : . : . : . : . :
JMFS107B09+ CACTTCCTTAACATTGGATGGTTGAAGAAAAGACTTTTCCAACAAGCCAACAGTTTTCCG
JMFF037E22+ CACTTCCTTAACATTGGATGGTTGAAGAAAAGACTTTTCCAACAAGCCAACAGTTTTCCG
JMFF036I03+ ATTGGATGGTTGAAGAAAAGACTTTTCCAACAAGCCAACAGTTTTCCG
JMFF030C10+ ATTGGATGGTTGAAGAAAAGACTTTTCCAACAAGCCAACAGTTTTCCG
                      ____________________________________________________________
consensus CACTTCCTTAACATTGGATGGTTGAAGAAAAGACTTTTCCAACAAGCCAACAGTTTTCCG
 
. : . : . : . : . : . :
JMFS107B09+ GACTCTTTCCTCATCAGCAAACCATTCCTCGTGCACCTTGTTCACACTCCAATTATAGCG
JMFF037E22+ GACTCTTTCCTCATCAGCAAACCATTCCTCGTGCACCTTGTTCACACTCCAATTATAGCG
JMFF036I03+ GACTCTTTCCTCATCAGCAAACCATTCCTCGTGCACCTTGTTCACACTCCAATTATAGCG
JMFF030C10+ GACTCTTTCCTCATCAGCAAACCATTCCTCGTGCACCTTGTTCACACTCCAATTATAGCG
JMFS111E08+ CCTCATCAGCAAACCATTCCTCGTGCACCTTGTTCACACTCCAATTATAGCG
                      ____________________________________________________________
consensus GACTCTTTCCTCATCAGCAAACCATTCCTCGTGCACCTTGTTCACACTCCAATTATAGCG
 
. : . : . : . : . : . :
JMFS107B09+ GCGTAAAAGTATGCATGCTGCTTCCCTTGGTATGGAAAGGACAGCAGAAATTCTATTTAT
JMFF037E22+ GCGTAAAAGTATGCATGCTGCTTCCCTTGGTATGGAAAGGACAGCAGAAATTCTATTTAT
JMFF036I03+ GCGTAAAAGTATGCATGCTGCTTCCCTTGGTATGGAAAGGACAGCAGAAATTCTATTTAT
JMFF030C10+ GCGTAAAAGTATGCATGCTGCTTCCCTTGGTATGGAAAGGACAGCAGAAATTCTATTTAT
JMFS111E08+ GCGTAAAAGTATGCATGCTGCTTCCCTTGGTATGGAAAGGACAGCAGAAATTCTATTTAT
                      ____________________________________________________________
consensus GCGTAAAAGTATGCATGCTGCTTCCCTTGGTATGGAAAGGACAGCAGAAATTCTATTTAT
 
. : . : . : . : . : . :
JMFS107B09+ ATCATCCTCTTGTCTTTGGCGTATGTCTTCTTCTTTCAAGACAGTGTAATTTTTCTGAGA
JMFF037E22+ ATCATCCTCTTGTCTTTGGCGTATGTCTTCTTCTTTCAAGACAGTGTAATTTTTCTGAGA
JMFF036I03+ ATCATCCTCTTGTCTTTGGCGTATGTCTTCTTCTTTCAAGACAGTGTAATTTTTCTGAGA
JMFF030C10+ ATCATCCTCTTGTCTTTGGCTTATGTCTTCTTCTTTCAAGACAGTGTAATTTTTCTGAGA
JMFS111E08+ ATCATCCTCTTGTCTTTGGCGTATGTCTTCTTCTTTCAAGACAGTGTAATTTTTCTGAGA
                      ____________________________________________________________
consensus ATCATCCTCTTGTCTTTGGCGTATGTCTTCTTCTTTCAAGACAGTGTAATTTTTCTGAGA
 
. : . : . : . : . : . :
JMFS107B09+ ACGACTGGTAGTGAGCTCATCAGAGTCATCAAACTCGTTGCCCATAAATTCGTAGTCAGC
JMFF037E22+ ACGACTGGTAGTGAGCTCATCAGAGTCATCAGACTCGTTGCCCATAAATTCGTAGTCAGC
JMFF036I03+ ACGACTGGTAGTGAGCTCATCAGAGTCATCAGACTCGTTGCCCATAAATTCGTAGTCAGC
JMFF030C10+ ACGACTGGTAGTGAGCTCATCAGAGTCATCAGACTCGTTGCCCATAAATTCGTAGTCAGC
JMFS111E08+ ACGACTGGTAGTGAGCTCATCAGAGTCATCAGACTCGTTGCCCATAAATTCGTAGTCAGC
                      ____________________________________________________________
consensus ACGACTGGTAGTGAGCTCATCAGAGTCATCAGACTCGTTGCCCATAAATTCGTAGTCAGC
 
. : . : . : . : . : . :
JMFS107B09+ TAAATCGGCGTCGCTGTCGCCGACGGCATCCCCGTAGCCGTAGCCTTCGCCATCGCTATA
JMFF037E22+ TAAATCGGCGTCGCTGTCGCCGACGGCATCCCCGTAGCCGTAGCCTTCGCCATCGCTATA
JMFF036I03+ TAAATCGGCGTCGCTGTCGCCGACGGCATCCCCGTAGCCGTAGCCTTCGCCATCGCTATA
JMFF030C10+ TAAATCGGCGTCGCTGTCGCCGACGGCATCCCCGTAGCCGTAGCCTTCGCCATCGCTATA
JMFF003K16+ GCTGTCGCCGACGGCATCCCCGTAGCCGTAGCCTTCGCCATCGCNATA
JMFS111E08+ TAAATCGGCGTCGCTGTCGCCGACGGCATCCCCGTAGCCGTAGCCTTCGCCATCGCTATA
JMSF009K03+ CCATCGCTATA
                      ____________________________________________________________
consensus TAAATCGGCGTCGCTGTCGCCGACGGCATCCCCGTAGCCGTAGCCTTCGCCATCGCTATA
 
. : . : . : . : . : . :
JMFS107B09+ GAAGTCCTCGTCTACGGACTCGAGGTCGTTGGCGTCGTGCATATCGTCATCGGACTCCAT
JMFF037E22+ GAAGTCCTCGTCTACGGACTCGAGGTCGTTGGCGTCGTGCATATCGTCATCGGACTCCAT
JMFF036I03+ GAAGTCCTCGTCTACGGACTCGAGGTCGTTGGCGTCGTGCATATCGTCATCGGACTCCAT
JMFF030C10+ GAAGTCCTCGTCTACGGACTCGAGGTCGTTGGCGTCGTGCATATCGTCATCGGACTCCAT
JMFF003K16+ GAAGTCCTCGTCTACGGACTCGAGGTCGTTGGCGTCGTGCATATCGTCATCGGACTCCAT
JMFS111E08+ GAAGTCCTCGTCTACGGACTCGAGGTCGTTGGCGTCGTGCATATCGTCATCGGACTCCAT
JMSF009K03+ GAAGTCCTCGTCTACGGACTCGAGGTCGTNGGCGTCGTGCATATCGTCATCGGACTCCAT
                      ____________________________________________________________
consensus GAAGTCCTCGTCTACGGACTCGAGGTCGTTGGCGTCGTGCATATCGTCATCGGACTCCAT
 
. : . : . : . : . : . :
JMFS107B09+ CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTCGAAGC
JMFF037E22+ CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTCGAAGC
JMFF036I03+ CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTCGAAGC
JMFF030C10+ CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTCGAAGC
JMFF003K16+ CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTNGAAGC
JMFS111E08+ CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTCGAAGC
JMSF009K03+ CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTCGAAGC
                      ____________________________________________________________
consensus CGGAAGCAGAAATGAAAACCCAGAACCCTAATGAAACCCTAGCACAGCTTGCGTCGAAGC
 
. : . : . : . : . : . :
JMFS107B09+ TGATCGAGCTCAGCGATCA
JMFF037E22+ TGATCGAGCTCAGCGATCATGAATAAATTGGAGCACAGATTGGAAGC
JMFF036I03+ TGATCGAGCTCAGCGATCATGAATAAATTGGAGCACAGATTGGAAGCGATCGAACACTTG
JMFF030C10+ TGATCGAGCTCAGCGATCATGAATAAATTGGAGCACAGATTGGAAGCGATCGAACACTTG
JMFF003K16+ TGATCGAGCTCAGCGATCATGAATAAATTGGAGCACAGATTGGAAGCGATCGAACACTTG
JMFS111E08+ TGATCGAGCTCAGCGATCATGAATAAATTGGAGCACAGATTGGAAGCGATCGAACACTTG
JMSF009K03+ TGATCGAGCTCAGCGATCATGAATAAATTGGAGCACAGATTGGAAGCGATCGAACACTTG
                      ____________________________________________________________
consensus TGATCGAGCTCAGCGATCATGAATAAATTGGAGCACAGATTGGAAGCGATCGAACACTTG
 
. : . : . : . : . : . :
JMFF036I03+ AACAAATTCTACGGATGAATGATTAAACT
JMFF030C10+ AACAAATTCTACGGATGAATGATTAAACT
JMFF003K16+ AACAAATTNTACGGATGAATGATTAAACT
JMFS111E08+ AACAAATTCTACGGATGAATGATTAAACTGACGAAAATTGATAATTAGGCATAGATACAT
JMSF009K03+ AACAAATTCTACGGATGAATGATTAAACTGACGAAAATTGATAATTAGGCATAGATACAT
                      ____________________________________________________________
consensus AACAAATTCTACGGATGAATGATTAAACTGACGAAAATTGATAATTAGGCATAGATACAT
 
. : . : . : . : . : . :
JMFS111E08+ GCACGCAGATAGATACACACGTATTCTTGGCCTCTTTTGGGTCGGGTGGAGGGTTTGGTA
JMSF009K03+ GCACGCAGATAGATACACACGTATTCTTGGCCTCTTTTGGGTCGGGTGGAGGGTTTGGTA
                      ____________________________________________________________
consensus GCACGCAGATAGATACACACGTATTCTTGGCCTCTTTTGGGTCGGGTGGAGGGTTTGGTA
 
. : . : . : . : . : . :
JMFS111E08+ AAGAAGTTCGGTTTTGGTTTTGGATTTGGTTTTCTTAGAAAAGTGGTTTC
JMSF009K03+ AAGAAGTTCGGTTTTGGTTTTGGATTTGGTTTTCTTAGAAAAGTGGTTTCGTCTCCAGGC
                      ____________________________________________________________
consensus AAGAAGTTCGGTTTTGGTTTTGGATTTGGTTTTCTTAGAAAAGTGGTTTCGTCTCCAGGC