Previous Contig 005081:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027I03Sequence560005081 (8)gb:AY088336_15733563e-71Arabidopsis thaliana clone 573 mRNA, complete sequence.681005081 (8)sp|P34091|RL6_MESCR1e-7160S ribosomal protein L6 (YL16-like).>pir|S28586|S28586 ribosomal protein ML16,
JMFN019A20Sequence613005081 (8)sp|P34091|RL6_MESCR4e-7160S ribosomal protein L6 (YL16-like).>pir|S28586|S28586 ribosomal protein ML16,
JMFN030M22Sequence443005081 (8)gb:AY088336_15733568e-57Arabidopsis thaliana clone 573 mRNA, complete sequence.
JMFN040J09Sequence626005081 (8)sp|P34091|RL6_MESCR5e-7560S ribosomal protein L6 (YL16-like).>pir|S28586|S28586 ribosomal protein ML16,
JMSF009I15Sequence345005081 (8)sp|P34091|RL6_MESCR3e-3360S ribosomal protein L6 (YL16-like).>pir|S28586|S28586 ribosomal protein ML16, 738005081 (8)sp|P34091|RL6_MESCR4e-8060S ribosomal protein L6 (YL16-like).>pir|S28586|S28586 ribosomal protein ML16,
JMSF011H09Sequence160005081 (8)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011H09+ TTTTTTTTTTGATCAGCAAAGAAAATCTGTTTGCATTCTCT
rJMFF027I03- TTCTCT
rJMSF009I15- GATCAGCAAAGAAAATCTGTTTGCATTCTCT
                      ____________________________________________________________
consensus TTTTTTTTTTGATCAGCAAAGAAAATCTGTTTGCATTCTCT
 
. : . : . : . : . : . :
JMSF011H09+ AAATTAAGAAGACTGTCACAGGCAAAACCAAAGCTTTAATAGAACAAGACAACATAACTA
rJMFF027I03- AAATTAAGAAGACTGTCACAGGCAAAACCAAAGCTTTAATAGAACAAGACAACATAACTA
rJMSF009I15- AAATTAAGAAGACTGTCACAGGCAAAACCAAAGCTTTAATAGAACAAGACAACATAACTA
                      ____________________________________________________________
consensus AAATTAAGAAGACTGTCACAGGCAAAACCAAAGCTTTAATAGAACAAGACAACATAACTA
 
. : . : . : . : . : . :
JMSF011H09+ AACAAAATCGGGTTTTGATATTTCACTAATTCAAAAGACAAGCTCATGAGGTTTCATGC
rJMFF027I03- AACAAAATCGGGTTTTGATATTTCACTAATTCAAAAGACAAGCTCATGAGGTTTCATGCC
rJMSF009I15- AACAAAATCGGGTTTTGATATTTCACTAATTCAAAAGACAAGCTCATGAGGTTTCATGCC
                      ____________________________________________________________
consensus AACAAAATCGGGTTTTGATATTTCACTAATTCAAAAGACAAGCTCATGAGGTTTCATGCC
 
. : . : . : . : . : . :
rJMFF027I03- TGCCTTAAGCGAGAACCTTGCACCCAAATAAGCCTTCAAATCCGGCACCGCTTCAATGGC
rJMSF009I15- TGCCTTAAGCGAGAACCTTGCACCCAAATAAGCCTTCAAATCCGGCACCGCTTCAATGGC
                      ____________________________________________________________
consensus TGCCTTAAGCGAGAACCTTGCACCCAAATAAGCCTTCAAATCCGGCACCGCTTCAATGGC
 
. : . : . : . : . : . :
rJMFF027I03- TTTGATCAATGCAGCATCCACAGCCTTCTGCTCATCTTTCTTTTCCTGTGGAATCACTTT
rJMSF009I15- TTTGATCAATGCAGCATCCACAGCCTTCTGCTCATCTTTCTTTTCCTGTGGAATCACTTT
JMFN040J09+ CAGCATCCACAGCCTTCTGCTCATCTTTCTTTTCCTGTGGAATCACTTT
JMFN019A20+ GCTCATCTTTCTTTTCCTGTGGAATCACTTT
                      ____________________________________________________________
consensus TTTGATCAATGCAGCATCCACAGCCTTCTGCTCATCTTTCTTTTCCTGTGGAATCACTTT
 
. : . : . : . : . : . :
rJMFF027I03- CTTCTCCTCTTTCTCAGACTCGAAGAACTCTCCTTCAGTCTTCGTCTTCTTCTTCTCAGC
rJMSF009I15- CTTCTCCTCTTTCTCAGACTCGAAGAACTCTCCTTCAGTCTTCGTCTTCTTCTTCTCAGC
JMFN040J09+ CTTCTCCTCTTTCTCAGACTCGAAGAACTCTCCTTCAGTCTTCGTCTTCTTCTTCTCAGC
JMFN019A20+ CTTCTCCTCTTTCTCAGACTCGAAGAACTCTCCTTCAGTCTTCGTCTTCTTCTTCTCAGC
JMFF027I03+ CTTCGTCTTCTTCTTCTCAGC
                      ____________________________________________________________
consensus CTTCTCCTCTTTCTCAGACTCGAAGAACTCTCCTTCAGTCTTCGTCTTCTTCTTCTCAGC
 
. : . : . : . : . : . :
rJMFF027I03- CTGCTTACCGAAGTACTTGTCATCAATCTTGTCCACATTGACCCCAGAAACGTCGACCTT
rJMSF009I15- CTGCTTACCGAAGTACTTGTCATCAATCTTGTCCACATTGACCCCAGAAACGTCGACCTT
JMFN040J09+ CTGCTTACCGAAGTACTTGTCATCAATCTTGTCCACATTGACCCCAGAAACGTCGACCTT
JMFN019A20+ CTGCTTACCGAAGTACTTGTCATCAATCTTGTCCACATTGACCCCAGAAACGTCGACCTT
JMFF027I03+ CTGCTTACCGAAGTACTTGTCATCAATCTTGTCCACATTGACCCCAGAAACGTCGACCTT
                      ____________________________________________________________
consensus CTGCTTACCGAAGTACTTGTCATCAATCTTGTCCACATTGACCCCAGAAACGTCGACCTT
 
. : . : . : . : . : . :
rJMFF027I03- GGTCGACGTTCCAATCACATACGCCTGATTCACGCGCCGCAAGGGAACGCCGTTGATCTT
rJMSF009I15- GGTCGACGTTCCAATCACATACGCCTGATTCACGCGCCGCAAGGGAACGCCGTTGATCTT
JMFN040J09+ GGTCGACGTTCCAATCACATACGCCTGATTCACGCGCCGCAAGGGAACGCCGTTGATCTT
JMFN019A20+ GGTCGACGTTCCAATCACATACGCCTGATTCACGCGCCGCAAGGGAACGCCGTTGATCTT
JMFN030M22+ TCCAATCACATACGCCTGATTCACGCGCCGCAAGGGAACGCCGTTGATCTT
JMFF027I03+ GGTCGACGTTCCAATCACATACGCCTGATTCACGCGCCGCAAGGGAACGCCGTTGATCTT
                      ____________________________________________________________
consensus GGTCGACGTTCCAATCACATACGCCTGATTCACGCGCCGCAAGGGAACGCCGTTGATCTT
 
. : . : . : . : . : . :
rJMFF027I03- GAACGGCCCGGTGACGAGAAGCAGACCGGACGGCAGCTGCTTCAGGAACACGACTCTCTT
rJMSF009I15- GAACGGCCCGGTGACGAGAAGCAGACCGGACGGCAGCTGCTTCAGGAACACGACTCTCTT
JMFN040J09+ GAACGGCCCGGTGACGAGAAGCAGACCGGACGGCAGCTGCTTCAGGAACACGACTCTCTT
JMFN019A20+ GAACGGCCCGGTGACGAGAAGCAGACCGGACGGCAGCTGCTTCAGGAACACGACTCTCTT
JMFN030M22+ GAACGGCCCGGTGACGAGAAGCAGACCGGACGGCAGCTGCTTCAGGAACACGACTCTCTT
JMFF027I03+ GAACGGCCCGGTGACGAGAAGCAGACCGGACGGCAGCTGCTTCAGGAACACGACTCTCTT
                      ____________________________________________________________
consensus GAACGGCCCGGTGACGAGAAGCAGACCGGACGGCAGCTGCTTCAGGAACACGACTCTCTT
 
. : . : . : . : . : . :
rJMFF027I03- GCCCTTGAACCGGCCGGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
rJMSF009I15- GCCCTTGAACCGGCCGGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
JMFN040J09+ GCCCTTGAACCGGCCGGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
JMFN019A20+ GCCCTTGAACCGGCCGGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
JMFN030M22+ GCCCTTGAACCGGCCGGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
JMFF027I03+ GCCCTTGAACCGGCCGGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
JMSF009I15+ GGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
                      ____________________________________________________________
consensus GCCCTTGAACCGGCCGGCGAGGATGATGAGAACGGTTCCCGGAGTGATGCTCGCCCTGAG
 
. : . : . : . : . : . :
rJMFF027I03- CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
rJMSF009I15- CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
JMFN040J09+ CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
JMFN019A20+ CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
JMFN030M22+ CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
JMFF027I03+ CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
JMSF009I15+ CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
                      ____________________________________________________________
consensus CTTAGCCGGCTTCGGCTTATGCTTGTTCACGAGCGGCTTCTTCACATCGTCGGCGGGGTA
 
. : . : . : . : . : . :
rJMFF027I03- GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
rJMSF009I15- GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
JMFN040J09+ GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
JMFN019A20+ GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
JMFN030M22+ GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
JMFF027I03+ GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
JMSF009I15+ GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
                      ____________________________________________________________
consensus GAACTTGGGCGGCTTTTCCACCGCCGCTGCCGCCGCCGGCTTCTTGTCGTGGCGCGGGAA
 
. : . : . : . : . : . :
rJMFF027I03- AGCGCCGC
rJMSF009I15- AGCGCCGCCGTTCTTAGCTTTGATGGCCCAAAGCCCTCTCTTGTGGT
JMFN040J09+ AGCGCCGCCGTTCTTAGCTTTGATGGCCCAAAGCCCTCTCTTGTGGTAGATCCTGGAGCG
JMFN019A20+ AGCGCCGCCGTTCTTAGCTTTGATGGCCCAAAGCCCTCTCTTGTGGTAGATCCTGGAGCG
JMFN030M22+ AGCGCCGCCGTTCTTAGCTTTGATGGCCCAAAGCCCTCTCTTGTGGTAGATCCTGGAGCG
JMFF027I03+ AGCGCCGCCGTTCTTAGCTTTGATGGCCCAAAGCCCTCTCTTGTGGTAGATCCTGGAGCG
JMSF009I15+ AGCGCCGCCGTTCTTAGCTTTGATGGCCCAAAGCCCTCTCTTGTGGTAGATCCTGGAGCG
                      ____________________________________________________________
consensus AGCGCCGCCGTTCTTAGCTTTGATGGCCCAAAGCCCTCTCTTGTGGTAGATCCTGGAGCG
 
. : . : . : . : . : . :
JMFN040J09+ CGAGTACTTTCCGACGCCCCTGATCAGCTCAGGGTTACGGGGACTCTTCTTCTTCTGCTG
JMFN019A20+ CGAGTACTTTCCGACGCCCCTGATCAGCTCAGGGTTACGGGGACTCTTCTTCTTCTGCTG
JMFN030M22+ CGAGTACTTTCCGACGCCCCTGATCAGCTCAGGGTTACGGGGACTCTTCTTCTTCTGCTG
JMFF027I03+ CGAGTACTTTCCGACGCCCCTGATCAGCTCAGGGTTACGGGGACTCTTCTTCTTCTGCTG
JMSF009I15+ CGAGTACTTTCCGACGCCCCTGATCAGCTCAGGGTTACGGGGACTCTTCTTCTTCTGCTG
                      ____________________________________________________________
consensus CGAGTACTTTCCGACGCCCCTGATCAGCTCAGGGTTACGGGGACTCTTCTTCTTCTGCTG
 
. : . : . : . : . : . :
JMFN040J09+ AGTGGCCGCCATTGAAGATTTGCAGTGAA
JMFN019A20+ AGTGGCCGCCATTGAAGATTTGCAGTGAAGCAGAGTGATGAT
JMFN030M22+ AGTGGCCGCCATTGAAGATTTGCAGTGAAGCA
JMFF027I03+ AGTGGCCGCCATTGAAGATTTGCAGTGAAGCAGAGTGATGATGCTCGATGCGTTATGCT
JMSF009I15+ AGTGGCCGCCATTGAAGATTTGCAGTGAAGCAGAGTGATGATGCTCGATGCGTTATGCTC
                      ____________________________________________________________
consensus AGTGGCCGCCATTGAAGATTTGCAGTGAAGCAGAGTGATGATGCTCGATGCGTTATGCTC