Previous Contig 005080:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN028E23Sequence642005080 (4)gb:BT004625_16376594e-70Arabidopsis thaliana At1g43800 gene, complete cds.
JMSF009I11Sequence324005080 (4)gb:AF139377_17714091e-17Lupinus luteus stearoyl acyl carrier protein desaturase Lldd3A20 mRNA, complete 779005080 (4)gb:AF139377_1771409e-104Lupinus luteus stearoyl acyl carrier protein desaturase Lldd3A20 mRNA, complete
JMSF038N15Sequence647005080 (4)gb:BT004625_16376597e-64Arabidopsis thaliana At1g43800 gene, complete cds.666002761 (6)gb:AY496128_11784636e-85Capsicum annuum 60S ribosomal protein L12 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009I11- ATATCATCCTGAATTAAATTAAATTTCATATAT
                      ____________________________________________________________
consensus ATATCATCCTGAATTAAATTAAATTTCATATAT
 
. : . : . : . : . : . :
rJMSF009I11- TATATAGTAACCTCCCTGTTGAAAATCCAGCTGAACTTCACCCCACGCGGCGCCAACTTC
                      ____________________________________________________________
consensus TATATAGTAACCTCCCTGTTGAAAATCCAGCTGAACTTCACCCCACGCGGCGCCAACTTC
 
. : . : . : . : . : . :
rJMSF009I11- TTGGCTCTCTCGTCGGCTCGCTCTTGCAGCTTCCTAATCCTCAACGGCAGTCTACACACG
                      ____________________________________________________________
consensus TTGGCTCTCTCGTCGGCTCGCTCTTGCAGCTTCCTAATCCTCAACGGCAGTCTACACACG
 
. : . : . : . : . : . :
rJMSF009I11- AAGTCCTGTGCGCCTCTTCCATCCCCGTTCAATCCCTCCATCTTCTCCAGTTTCCACCGT
                      ____________________________________________________________
consensus AAGTCCTGTGCGCCTCTTCCATCCCCGTTCAATCCCTCCATCTTCTCCAGTTTCCACCGT
 
. : . : . : . : . : . :
rJMSF009I11- CCGATCAAAAACTCCAAGATATCCGCGTAGTCGTGAGCCGTGTAAACGCCGAGGCGCTGA
                      ____________________________________________________________
consensus CCGATCAAAAACTCCAAGATATCCGCGTAGTCGTGAGCCGTGTAAACGCCGAGGCGCTGA
 
. : . : . : . : . : . :
rJMSF009I11- GCCACCGCCGAGAAGTGCTCGAAGAGATTAATATCTTGGCCGTCGTACATGAGGTGAGCC
                      ____________________________________________________________
consensus GCCACCGCCGAGAAGTGCTCGAAGAGATTAATATCTTGGCCGTCGTACATGAGGTGAGCC
 
. : . : . : . : . : . :
rJMSF009I11- GGCATTGTGATCTTCTTCCTCATCATGTCGGCTATGGCGAGCATGGCGCCGTTGGGGTCC
                      ____________________________________________________________
consensus GGCATTGTGATCTTCTTCCTCATCATGTCGGCTATGGCGAGCATGGCGCCGTTGGGGTCC
 
. : . : . : . : . : . :
rJMSF009I11- ACTTCCAGCAGCTTCTCCACGATGTTCGCGTACGCGTTCTCGTGCCGCTTCTCGTCCGCC
                      ____________________________________________________________
consensus ACTTCCAGCAGCTTCTCCACGATGTTCGCGTACGCGTTCTCGTGCCGCTTCTCGTCCGCC
 
. : . : . : . : . : . :
rJMSF009I11- GCAATGCTGCCGCAAATGCGCGCCAGCGCCAGATCGCCGCCCTCCTTGGCTAGCCGAGCC
                      ____________________________________________________________
consensus GCAATGCTGCCGCAAATGCGCGCCAGCGCCAGATCGCCGCCCTCCTTGGCTAGCCGAGCC
 
. : . : . : . : . : . :
rJMSF009I11- GTGTTGCCGTGCGACACGAATGTGGCTCGCTCTTGGAATGACGTGTATACGAATCCCAAA
JMFN028E23+ TGGAATGACGGGTATACGAATCCCAAA
                      ____________________________________________________________
consensus GTGTTGCCGTGCGACACGAATGTGGCTCGCTCTTGGAATGACGTGTATACGAATCCCAAA
 
. : . : . : . : . : . :
rJMSF009I11- TACGGGTTGTTTTCCGTGCCCGGATCCATTCCAACGCCAAGCAAGTACTGCACCGTTTTT
JMFN028E23+ TACGGGTTGTTTNCCGTGCCCGGATCCATTCCAACGCCAAGCAAGTACTGCACCGTTTTT
JMSF038N15+ CCGTGCCCGGATCCATTCCAACGCCAAGCAAGTACTGCACCGTTTTT
                      ____________________________________________________________
consensus TACGGGTTGTTTTCCGTGCCCGGATCCATTCCAACGCCAAGCAAGTACTGCACCGTTTTT
 
. : . : . : . : . : . :
rJMSF009I11- TCGATCATGGTCATATCGACCCGACCCGAAAGGTAGAGGTAGGTCCGGAGCAAATCGCCG
JMFN028E23+ TCGATCATGGTCATATCGACCCGACCCGAAAGGTAGAGGTAGGTCCGGAGCAAATCGCCG
JMSF038N15+ TCGATCATGGTCATATCGACCCGACCCGAAAGGTAGAGGTAGGTCCGGAGCAAATCGCCG
                      ____________________________________________________________
consensus TCGATCATGGTCATATCGACCCGACCCGAAAGGTAGAGGTAGGTCCGGAGCAAATCGCCG
 
. : . : . : . : . : . :
rJMSF009I11- TGGCGGTTCTCCTCGGCGGTCCAGGCTCGAGTCCAAGCCGCCCAAGGA-TCTGGCTGGCG
JMFN028E23+ TGGCGGTTCTCCTCGGCGGTCCAGGCTCGAGTCCAAGCCGCCCAAGGATTCTGGCTGGCG
JMSF038N15+ TGGCGGTTCTCCTCGGCGGTCCAGGCTCGAGTCCAAGCCGCCCAAGGATTCTGGCTGGCG
                      ____________________________________________________________
consensus TGGCGGTTCTCCTCGGCGGTCCAGGCTCGAGTCCAAGCCGCCCAAGGATTCTGGCTGGCG
 
. : . : . : . : . : . :
rJMSF009I11- CCGGTCTCATCGCGCACCC
JMFN028E23+ CCGGTCTCATCGCGCACCCCGTCAAGCGTGTTAATCATGGTCTGATAAGTCGGCAGCGCG
JMSF038N15+ CCGGTCTCATCGCGCACCCCGTCAAGCGTGTTAATCATGGTCTGATAAGTCGGCAGCGCG
                      ____________________________________________________________
consensus CCGGTCTCATCGCGCACCCCGTCAAGCGTGTTAATCATGGTCTGATAAGTCGGCAGCGCG
 
. : . : . : . : . : . :
JMFN028E23+ TCCTCGGTGATCATATCGCCGACCAGAACCACAAAGTAATCGTCCGGAAGGCCGGAGTTC
JMSF038N15+ TCCTCGGTGATCATATCGCCGACCAGAACCACAAAGTAATCGTCCGGAAGGCCGGAGTTC
                      ____________________________________________________________
consensus TCCTCGGTGATCATATCGCCGACCAGAACCACAAAGTAATCGTCCGGAAGGCCGGAGTTC
 
. : . : . : . : . : . :
JMFN028E23+ CGTTCCCGGAGCGCCCGAACCTCATCGAAGAACTCGTCGGAGGGACGGGACGGGTCGGGG
JMSF038N15+ CGTTCCCGGAGCGCCCGAACCTCATCGAAGAACTCGTCGGAGGGACGGGACGGGTCGGGG
JMSF009I11+ GTCGGAGGGACGGGACGGGTCGGGG
                      ____________________________________________________________
consensus CGTTCCCGGAGCGCCCGAACCTCATCGAAGAACTCGTCGGAGGGACGGGACGGGTCGGGG
 
. : . : . : . : . : . :
JMFN028E23+ AGGAACTCGTTGGGCTGCCAGCATTTCTCCACCGGCTTCAGGAGAGGGAGGACCGAGTTC
JMSF038N15+ AGGAACTCGTTGGGCTGCCAGCATTTCTCCACCGGCTTCAGGAGAGGGAGGACCGAGTTC
JMSF009I11+ AGGAACTCGTTGGGCTGCCAGCATTTCTCCACCGGCTTCAGGAGAGGGAGGACCGAGTTC
                      ____________________________________________________________
consensus AGGAACTCGTTGGGCTGCCAGCATTTCTCCACCGGCTTCAGGAGAGGGAGGACCGAGTTC
 
. : . : . : . : . : . :
JMFN028E23+ GACGCCCAGGACTATAGCGACTTGAAAATCTCGACTTTTTCGGGGGGCATCGAGTGCGTC
JMSF038N15+ GACGCCCAGGACTCTAGCGACTTGAAAATCTCGACTTTTTCGGGGGGCATCGAGTGCGTC
JMSF009I11+ GACGCCCAGGACTCTAGCGACTTGAAAATCTCGACTTTTTCGGGGGGCATCGAGTGCGTC
                      ____________________________________________________________
consensus GACGCCCAGGACTCTAGCGACTTGAAAATCTCGACTTTTTCGGGGGGCATCGAGTGCGTC
 
. : . : . : . : . : . :
JMFN028E23+ GTCTGGTAACGGAGCGGCTGCGGCGGGGCGGCAATGGCTGAGATCGGCGCTACACGGCGG
JMSF038N15+ GTCTGGTAACGGAGCGGCTGCGGCGGGGCGGCAATGGCTGAGATCGGCGCTACACGGCGG
JMSF009I11+ GTCTGGTAACGGAGCGGCTGCGGCGGGGCGGCAATGGCTGAGATCGGCGCTACACGGCGG
                      ____________________________________________________________
consensus GTCTGGTAACGGAGCGGCTGCGGCGGGGCGGCAATGGCTGAGATCGGCGCTACACGGCGG
 
. : . : . : . : . : . :
JMFN028E23+ TGGAGGGCGGCCGGAAAGGCAGATGGAGAGCATGCAAGTGTGTTGGCGGTGGCGGAGAAT
JMSF038N15+ TGGAGGGCGGCCGGAAAGGCAGATGGAGAGCATGCAAGTGTGTTGGCGGTGGCGGAGAAT
JMSF009I11+ TGGAGGGCGGCCGGAAAGGCAGATGGAGAGCATGCAAGTGTGTTGGCGGTGGCGGAGAAT
                      ____________________________________________________________
consensus TGGAGGGCGGCCGGAAAGGCAGATGGAGAGCATGCAAGTGTGTTGGCGGTGGCGGAGAAT
 
. : . : . : . : . : . :
JMFN028E23+ ACTAAGAATTGCTGC
JMSF038N15+ ACTAAGAATTGCTGCATGCTTACAATCAGGAAGAAAAGTCAAAACGTCTGGGTTGCAA
JMSF009I11+ ACTAAGAATTGCTGCATGCTTACAATCAGGAAGAAAAGCC-AAACGTCTGGGTTGCAACC
                      ____________________________________________________________
consensus ACTAAGAATTGCTGCATGCTTACAATCAGGAAGAAAAGTCAAAACGTCTGGGTTGCAACC