Previous Contig 005067:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003C04Sequence332005067 (3)708011495 (3)gb:AK176863_18188511e-85Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-42-C07.
JMSF009D24Sequence417005067 (3)gb:AK176863_18188514e-07Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-42-C07.709011495 (3)gb:AK176863_18188511e-85Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-42-C07.
JMSF051J14Sequence626005067 (3)gb:AK176863_18188519e-42Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-42-C07.740011495 (3)gb:AC006234_15338162e-97Arabidopsis thaliana chromosome 2 clone F5H14 map mi148, complete sequence.>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051J14+ CTCTGTC
                      ____________________________________________________________
consensus CTCTGTC
 
. : . : . : . : . : . :
JMSF051J14+ ACGGAATTCAATTGCTCTCCAAGTGATTGGATATTGGCCTTTAATCTCATAATCATGGTT
                      ____________________________________________________________
consensus ACGGAATTCAATTGCTCTCCAAGTGATTGGATATTGGCCTTTAATCTCATAATCATGGTT
 
. : . : . : . : . : . :
JMSF051J14+ GCACTATCATAGTGGAGTTGCTGGGCTTGACAAAGCAGAAGTGCCATTTCACGGATTCTT
                      ____________________________________________________________
consensus GCACTATCATAGTGGAGTTGCTGGGCTTGACAAAGCAGAAGTGCCATTTCACGGATTCTT
 
. : . : . : . : . : . :
JMSF051J14+ GATTCTGCCTCTTTCATCGTTAATGGGGTTTTCCTCGTCGCTGAATTTGATAGGAGTACT
                      ____________________________________________________________
consensus GATTCTGCCTCTTTCATCGTTAATGGGGTTTTCCTCGTCGCTGAATTTGATAGGAGTACT
 
. : . : . : . : . : . :
JMSF051J14+ TGTGATTTGTGAATCTTGGCACTTATTTCCCATGCAAGTTGAAGGTTGTTGCTCTCTTTT
                      ____________________________________________________________
consensus TGTGATTTGTGAATCTTGGCACTTATTTCCCATGCAAGTTGAAGGTTGTTGCTCTCTTTT
 
. : . : . : . : . : . :
JMSF051J14+ GCAATCAGAACAAAGGATTTAGCAAGAGATATTTGATCATTCACTTGCCTAGATATTGAA
JMSF009D24+ ATCAGAACAANGGATTTAGCAAGAGATATTTGATCATTCACTTGCCTAGATATTGAA
                      ____________________________________________________________
consensus GCAATCAGAACAAAGGATTTAGCAAGAGATATTTGATCATTCACTTGCCTAGATATTGAA
 
. : . : . : . : . : . :
JMSF051J14+ TGAGGGTCCAACATTTCTTCGGTGATGTTAAAACCTTCCAGAAATTTGTTCCGTCTATTA
JMSF003C04+ TTCGGTGATGTTAAAACCTTCCAGAAATTTGTTCCGTCTATTA
JMSF009D24+ TGAGGGTCCAACATTTCTTCGGTGATGTTAAAACCTTCCAGAAATTTGTTCCGTCTATTA
                      ____________________________________________________________
consensus TGAGGGTCCAACATTTCTTCGGTGATGTTAAAACCTTCCAGAAATTTGTTCCGTCTATTA
 
. : . : . : . : . : . :
JMSF051J14+ AATCCCTGGATTAAAGAAGGCGTGGAGGGAGAAGAGCTTTTCTGGCGGATGATGGCGAAT
JMSF003C04+ AATCCCTGGATTAAAGAAGGCGTGGAGGGAGAAGAGCTTTTCTGGCGGATGATGGCGAAT
JMSF009D24+ AATCCCTGGATTAAAGAAGGCGTGGAGGGAGAAGAGCTTTTCTGGCGGATGATGGCGAAT
                      ____________________________________________________________
consensus AATCCCTGGATTAAAGAAGGCGTGGAGGGAGAAGAGCTTTTCTGGCGGATGATGGCGAAT
 
. : . : . : . : . : . :
JMSF051J14+ AAGAGAAGCGCTAAGAAGGCGCAGAATATCAGCCATCCCAGTTTGGAGTACCGTCTCTTT
JMSF003C04+ AAGAGAAGCGCTAAGAAGGCGCAGAATATCAGCCATCCCAGTTTGGAGTACCGTCTCTTT
JMSF009D24+ AAGAGAAGCGCTAAGAAGGCGCAGAATATCAGCCATCCCAGTTTGGAGTACCGTCTCTTT
                      ____________________________________________________________
consensus AAGAGAAGCGCTAAGAAGGCGCAGAATATCAGCCATCCCAGTTTGGAGTACCGTCTCTTT
 
. : . : . : . : . : . :
JMSF051J14+ GCGGGTCTGCTTCGAAAATCGAACGACCTTCGCCTCATTGAAAATCTCCCCTTCCTATTT
JMSF003C04+ GCGGGTCTGCTTCGAAAATCGAACGACCTTCGCCTCATTGAAAATCTCCCCTTCCTATTT
JMSF009D24+ GCGGGTCTGCTTCGAAAATCGAACGACCTTCGCCTCATTGAAAATCTCCCCTTCCTATTT
                      ____________________________________________________________
consensus GCGGGTCTGCTTCGAAAATCGAACGACCTTCGCCTCATTGAAAATCTCCCCTTCCTATTT
 
. : . : . : . : . : . :
JMSF051J14+ TTGCATCAAACCAACAAAAACCTCCCCAGAAAGCTTCACTGTGTGGGTTCCTGAGTGAAG
JMSF003C04+ TTGCATCAAACCAACAAAAACCTCCCCAGAAAGCTTCACTGTGTGGGTTCCTGAGTGAAG
JMSF009D24+ TTGCATCAAACCAACAAAAACCTCCCCAGAAAGCTTCACTGTGTGGGTTCCTGAGTGAAG
                      ____________________________________________________________
consensus TTGCATCAAACCAACAAAAACCTCCCCAGAAAGCTTCACTGTGTGGGTTCCTGAGTGAAG
 
. : . : . : . : . : . :
JMSF051J14+ GAGTCGAAATTTAGCT
JMSF003C04+ GAGTCGAAATTTAGCTGTGGGTGCTCCGGAGAGAGTTCACAAACTGT
JMSF009D24+ GAGTCGAAATTTAGCTGTGGGTGCTCCGGAGAGAGTTCACAAACTGTTATCAGATCACTC
                      ____________________________________________________________
consensus GAGTCGAAATTTAGCTGTGGGTGCTCCGGAGAGAGTTCACAAACTGTTATCAGATCACTC