Previous Contig 005065:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS014D03Sequence585005065 (11)gb:AB084380_15243359e-43Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS017F10Sequence615005065 (11)gb:AB084380_15243352e-48Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS034D12Sequence522005065 (11)gb:AB084380_15243352e-27Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS062H02Sequence627005065 (11)gb:AB084380_15243351e-42Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS096B11Sequence608005065 (11)gb:AB084380_15243355e-43Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS129D01Sequence625005065 (11)gb:AB084380_15243353e-43Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS136G09Sequence608005065 (11)gb:AB084380_15243358e-45Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS148H07Sequence613005065 (11)gb:AB084380_15243354e-52Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMSF009D04Sequence295005065 (11)782011896 (4)pir|E96561|E965616e-96hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931
JMSF016I03Sequence267005065 (11)797011896 (4)pir|E96561|E965614e-94hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931
JMSF050L08Sequence655005065 (11)gb:AB084380_15243352e-44Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.784011896 (4)pir|E96561|E965612e-97hypothetical protein F5F19.21 [imported] - Arabidopsis thaliana>gb:AE005173_8931

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS148H07+ ACACCAAATGTGAAACTTGCTTCTGCAGCCTATC
JMFS017F10+ GCAGCCTATC
                      ____________________________________________________________
consensus ACACCAAATGTGAAACTTGCTTCTGCAGCCTATC
 
. : . : . : . : . : . :
JMFS148H07+ ATTCTCCTCCATCAACAGCTTGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
JMFS017F10+ ATTCTCCTCCATCAACAGCTTGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
JMFS062H02+ TGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
JMFS129D01+ AGCTTGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
JMFS096B11+ CAGCTTGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
JMFS136G09+ CATCAACAGCTTGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
JMFS014D03+ TGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
JMSF050L08+ CATCAACAGCTTGTTCATTGCTGTCAACTTTCGATTCACGGCTNGGAGACG
                      ____________________________________________________________
consensus ATTCTCCTCCATCAACAGCTTGTTCATTGCTGTCAACTTTCGATTCACGGCTTGGAGACG
 
. : . : . : . : . : . :
JMFS148H07+ AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
JMFS017F10+ AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
JMFS034D12+ CCAAACTTTGATCTG
JMFS062H02+ AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
JMFS129D01+ AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
JMFS096B11+ AGACGACTCTNTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
JMFS136G09+ AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
JMFS014D03+ AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
JMSF050L08+ AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
                      ____________________________________________________________
consensus AGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAACCAAACTTTGATCTG
 
. : . : . : . : . : . :
JMFS148H07+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMFS017F10+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMFS034D12+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMFS062H02+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMFS129D01+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMFS096B11+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMFS136G09+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMFS014D03+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
JMSF050L08+ TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
                      ____________________________________________________________
consensus TTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTGCTGCCTGCGAAGCGA
 
. : . : . : . : . : . :
JMFS148H07+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMFS017F10+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMFS034D12+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMFS062H02+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMFS129D01+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMFS096B11+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMFS136G09+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMFS014D03+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
JMSF050L08+ ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
                      ____________________________________________________________
consensus ACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGATCTGCTCCGGTGTGTA
 
. : . : . : . : . : . :
JMFS148H07+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMFS017F10+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMFS034D12+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMFS062H02+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMFS129D01+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMFS096B11+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMFS136G09+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMFS014D03+ CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
JMSF050L08+ CCGCACATATTTCCCATTGTCCAATCCCATTATCCCACTCTCTTTACAGCTCGATGTCAC
                      ____________________________________________________________
consensus CCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTTACAGCTCGATGTCAC
 
. : . : . : . : . : . :
JMFS148H07+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAA-TCCCAGCAATAATCC
JMFS017F10+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
JMFS034D12+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
JMFS062H02+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
JMFS129D01+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
JMFS096B11+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
JMFS136G09+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
JMFS014D03+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
JMSF050L08+ CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
                      ____________________________________________________________
consensus CGCCATCATCACTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCC
 
. : . : . : . : . : . :
JMFS148H07+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMFS017F10+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMFS034D12+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMFS062H02+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMFS129D01+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMFS096B11+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMFS136G09+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMFS014D03+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMSF050L08+ ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
JMSF016I03+ CCACGCAGCGTGAAGCACAAGGCTGCTGA
JMSF009D04+ CTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
                      ____________________________________________________________
consensus ACTCTCTACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGA
 
. : . : . : . : . : . :
JMFS148H07+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMFS017F10+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMFS034D12+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMFS062H02+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMFS129D01+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMFS096B11+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMFS136G09+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMFS014D03+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMSF050L08+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMSF016I03+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
JMSF009D04+ GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
                      ____________________________________________________________
consensus GATCTTCCATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAA
 
. : . : . : . : . : . :
JMFS148H07+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMFS017F10+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMFS034D12+ CCAACCAAACCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMFS062H02+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMFS129D01+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMFS096B11+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMFS136G09+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMFS014D03+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMSF050L08+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMSF016I03+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
JMSF009D04+ CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
                      ____________________________________________________________
consensus CCAACCAAGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTT
 
. : . : . : . : . : . :
JMFS148H07+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATAT
JMFS017F10+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMFS034D12+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMFS062H02+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMFS129D01+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMFS096B11+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMFS136G09+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMFS014D03+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMSF050L08+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMSF016I03+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
JMSF009D04+ GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
                      ____________________________________________________________
consensus GTATATAGGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACA
 
. : . : . : . : . : . :
JMFS017F10+ GAAGA
JMFS034D12+ GAAGAGAGTACGTGGTTGAGGGAGAGA
JMFS062H02+ GAAGAGAGTACGTGGTTGAGGGAGAGAGAGAGGAAGAAGAAGAAGAA
JMFS129D01+ GAAGAGAGTACGTGGTTGAGGGAGAGAGAGAGGAAGAAGAA
JMFS096B11+ GAAGAGAGTACGTGGTTGAGGGA
JMFS136G09+ GAAGAGAGTACGTGGTT
JMFS014D03+ GAAGA
JMSF050L08+ GAAGAGAGTACGTGGTTGAGGGAGGGAGAGAGGAAGAAGAAGAAGAAGACGCTTCTC
JMSF016I03+ GAAGAGAGTACGTGGTTGAGGGAGAGAGAGAGGAAGAAGAAGAAGAAGACGCTTCTC
JMSF009D04+ GAAGAGAGTACGTGGTTGAGGGAGAGAGAGAGGAAGAAGAAGAAGAAGACGCTTCTCATC
                      ____________________________________________________________
consensus GAAGAGAGTACGTGGTTGAGGGAGAGAGAGAGGAAGAAGAAGAAGAAGACGCTTCTCATC