Previous Contig 005064:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034A17Sequence507005064 (5)pir|F86410|F864104e-17protein F3M18.12 [imported] - Arabidopsis thaliana>gb:AE005172_891730 Arabidopsi747010908 (5)gb:BT004058_16371671e-62Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMFF034L24Sequence605005064 (5)pir|F86410|F864103e-22protein F3M18.12 [imported] - Arabidopsis thaliana>gb:AE005172_891730 Arabidopsi742010908 (5)gb:BT004058_16371674e-69Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMFF049H07Sequence642005064 (5)pir|F86410|F864102e-24protein F3M18.12 [imported] - Arabidopsis thaliana>gb:AE005172_891730 Arabidopsi641010908 (5)gb:BT004058_16371674e-40Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMSF009D03Sequence300005064 (5)gb:T1N24_17236660.014Arabidopsis thaliana BAC T1N24.791010908 (5)putativereceptor protein kinase (At5g25930) mRNA, complete cds.>gb:T1N24_1723664 Arabido
JMSF029A13Sequence596005064 (5)pir|F86410|F864105e-21protein F3M18.12 [imported] - Arabidopsis thaliana>gb:AE005172_891730 Arabidopsi722010908 (5)gb:BT004058_16371671e-74Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF034L24+ GTTGTAAAAATTTCCTATA
JMFF049H07+ CAAAGAATTCATGGACAAATCTAAGTAGCTAAGGTTGTAAAAATTTCCTATA
                      ____________________________________________________________
consensus CAAAGAATTCATGGACAAATCTAAGTAGCTAAGGTTGTAAAAATTTCCTATA
 
. : . : . : . : . : . :
JMFF034L24+ TCATCTGGTATAGATCCATTCAAATCGTTACTTGAAACATCAAGAGACTCCAAACTATAA
JMFF049H07+ TCATCTGGTATAGATCCATTCAAATCGTTACTTGAAACATCAAGAGACTCCAAACTATAA
JMSF029A13+ ATCTGGTATAGATCCATTCAAATCGTTACTTGAAACATCAAGAGACTCCAAACTATAA
                      ____________________________________________________________
consensus TCATCTGGTATAGATCCATTCAAATCGTTACTTGAAACATCAAGAGACTCCAAACTATAA
 
. : . : . : . : . : . :
JMFF034L24+ GCCACCATGGGTGTCGGTATCTCACCGAACAACATGTTGCCTCGAAGATTTAAACTACGC
JMFF049H07+ GCCACCATGGGTGTCGGTATCTCACCGAACAACATGTTGCCTCGAAGATTTAAACTACGC
JMFF034A17+ CGAACAACATGTTGCCTCGAAGATTTAAACTACGC
JMSF029A13+ GCCACCATGGGTGTCGGTATCTCACCGAACAACATGTTGCCTCGAAGATTTAAACTACGC
                      ____________________________________________________________
consensus GCCACCATGGGTGTCGGTATCTCACCGAACAACATGTTGCCTCGAAGATTTAAACTACGC
 
. : . : . : . : . : . :
JMFF034L24+ AGGGTTTTCATGGAAAAAAACTCACCTGCTATTTTTCCTGTCAAATCATTTATGGATAGA
JMFF049H07+ AGGGTTTTCATGGAAAAAAACTCACCTGCTATTTTTCCTGTCAAATCATTTATGGATAGA
JMFF034A17+ AGGGTTTTCATGGAAAAAAACTCACCTGCTATTTTTCCTGTCAAATCATTTATGGATAGA
JMSF029A13+ AGGGTTTTCATGGAAAAAAACTCACCTGCTATTTTTCCTGTCAAATCATTTATGGATAGA
                      ____________________________________________________________
consensus AGGGTTTTCATGGAAAAAAACTCACCTGCTATTTTTCCTGTCAAATCATTTATGGATAGA
 
. : . : . : . : . : . :
JMFF034L24+ TCTAAGGTTTCAAGCTTTGAGCAGCTGGATAGGTTAGCTGGTATAGTTCCCCAAAGACTA
JMFF049H07+ TCTAAGGTTTCAAGCTTTGAGCAGCTGGATAGGTTAGCTGGTATAGTTCCCCAAAGACTA
JMFF034A17+ TCTAAGGTTTCAAGCTTTGAGCAGCTGGATAGGTTAGCTGGTATAGTTCCCCAAAGACTA
JMSF029A13+ TCTAAGGTTTCAAGCTTTGAGCAGCTGGATAGGTTAGCTGGTATAGTTCCCCAAAGACTA
                      ____________________________________________________________
consensus TCTAAGGTTTCAAGCTTTGAGCAGCTGGATAGGTTAGCTGGTATAGTTCCCCAAAGACTA
 
. : . : . : . : . : . :
JMFF034L24+ TTGGAACTGAAATTGATTGAAACAAGGTTGTTGAGCTGGCATATAATAGCTGAGGCAGGG
JMFF049H07+ TTGGAACTGAAATTGATTGAAACAAGGTTGTTGAGCTGGCATATAATAGCTGAGGCAGGG
JMFF034A17+ TTGGAACTGAAATTGATTGAAACAAGGTTGTTGAGCTGGCATATAATAGCTGAGGCAGGG
JMSF029A13+ TTGGAACTGAAATTGATTGAAACAAGGTTGTTGAGCTGGCATATAATAGCTGAGGCAGGG
                      ____________________________________________________________
consensus TTGGAACTGAAATTGATTGAAACAAGGTTGTTGAGCTGGCATATAATAGCTGAGGCAGGG
 
. : . : . : . : . : . :
JMFF034L24+ AATGATCCTCCCATGATCATTTCGGAGAGAGATATCCGTGTGACACTTCCATTGGAGTTG
JMFF049H07+ AATGATCCTCCCATGATCATTTCGGAGAGAGATATCCGTGTGACACTTCCATTGGAGTTG
JMFF034A17+ AATGATCCTCCCATGATCATTTCGGAGAGAGATATCCGTGTGACACTTCCATTGGAGTTG
JMSF029A13+ AATGATCCTCCCATGATCATTTCGGAGAGAGATATCCGTGTGACACTTCCATTGGAGTTG
                      ____________________________________________________________
consensus AATGATCCTCCCATGATCATTTCGGAGAGAGATATCCGTGTGACACTTCCATTGGAGTTG
 
. : . : . : . : . : . :
JMFF034L24+ CATGAAATTCCAGGCCAGTCACATGGGGAGGAAGTGGAGTTCCACTGCTCAAATAGTGAA
JMFF049H07+ CATGAAATTCCAGGCCAGTCACATGGGGAGGAAGTGGAGTTCCACTGCTCAAATAGTGAA
JMFF034A17+ CATGAAATTCCAGGCCAGTCACATGGGGAGGAAGTGGAGTTCCACTGCTCAAATAGTGAA
JMSF029A13+ CATGAAATTCCAGGCCAGTCACATGGGGAGGAAGTGGAGTTCCACTGCTCAAATAGTGAA
JMSF009D03+ CATGAAATTCCAGGCCAGTCACATGGGGAGGAAGTGGAGTTCCACTGCTCAAATAGTGAA
                      ____________________________________________________________
consensus CATGAAATTCCAGGCCAGTCACATGGGGAGGAAGTGGAGTTCCACTGCTCAAATAGTGAA
 
. : . : . : . : . : . :
JMFF034L24+ AATGGATACCCCCAGTGTTGTTTTAGGATAAGTAAAATAGCCCTTTCATCCTCCCCATAA
JMFF049H07+ AATGGATACCCCCAGTGTTGTTTTAGGATAAGTAAAATAGCCCTTTCATCCTCCCCATAA
JMFF034A17+ AATGGATACCCCCAGTGTTGTTTTAGGATAAGTAAAATAGCCCTTTCATCCTCCCCATAA
JMSF029A13+ AATGGATACCCCCAGTGTTGTTTTAGGATAAGTAAAATAGCCCTTTCATCCTCCCCATAA
JMSF009D03+ AATGGATACCCCCAGTGTTGTTTTAGGATAAGTAAAATAGCCCTTTCATCCTCCCCATAA
                      ____________________________________________________________
consensus AATGGATACCCCCAGTGTTGTTTTAGGATAAGTAAAATAGCCCTTTCATCCTCCCCATAA
 
. : . : . : . : . : . :
JMFF034L24+ GTGGTTAAAGATTGTGAATAATTTGGGAAGGAGAAAAGGAGGAGCATGAAGAAGAAGAAG
JMFF049H07+ GTGGTTAAAGATTGTGAATAATTTGGGAAGGAGAAAAGGAGGAGCATGAAGAAGAAGAAG
JMFF034A17+ GTGGTTAAAGATTGTGAATAATTTGGGAAGGAGAAAAGGAGGAGCATGAAGAAGAAGAAG
JMSF029A13+ GTGGTTAAAGATTGTGAATAATTTGGGAAGGAGAAAAGGAGGAGCATGAAGAAGAAGAAG
JMSF009D03+ GTGGTTAAAGATTGTGAATAATTTGGGAAGGAGAAAAGGAGGAGCATGAAGAAGAAGAAG
                      ____________________________________________________________
consensus GTGGTTAAAGATTGTGAATAATTTGGGAAGGAGAAAAGGAGGAGCATGAAGAAGAAGAAG
 
. : . : . : . : . : . :
JMFF034L24+ AAGGCATGATGAATAGGGTGGTGCACCACCATTTTCAGCTAATAAT
JMFF049H07+ AAGGCATGATGAATAGGGTGGTGCACCACCATTTTCAGCTAATAATAATA
JMFF034A17+ AAGGCATGATGAATAGGGTGGTGCACCACCATTTTCAGCTAATAATAATA
JMSF029A13+ AAGGCATGATGAATAGGGTGGTGCACCACCATTTTCAGCTAATAATAATAAG
JMSF009D03+ AAGGCATGATGAATAGGGTGGTGCACCACCATTTTCAGCTAATAATAATAAGATGGTGAG
                      ____________________________________________________________
consensus AAGGCATGATGAATAGGGTGGTGCACCACCATTTTCAGCTAATAATAATAAGATGGTGAG
 
. : . : . : . : . : . :
JMSF009D03+ GATCTTGCTGCTCTCATCTATTATATTATTGTATTGCTTAATGTGAACAACAAAGTTCCC
                      ____________________________________________________________
consensus GATCTTGCTGCTCTCATCTATTATATTATTGTATTGCTTAATGTGAACAACAAAGTTCCC