Previous Contig 005062:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS031C11Sequence592005062 (4)gb:AY094418_15757192e-64Arabidopsis thaliana AT3g05970/F2O10_9 mRNA, complete cds.>gb:BT001117_1635372 A
JMSF009C22Sequence319005062 (4)gb:AF503756_18067573e-04Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds778009572 (4)gb:AF503756_1806757e-109Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds
JMSF019D09Sequence225005062 (4)806009572 (4)gb:AF503756_18067577e-65Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds
JMSF039A24Sequence644005062 (4)gb:AY094418_15757192e-71Arabidopsis thaliana AT3g05970/F2O10_9 mRNA, complete cds.>gb:BT001117_1635372 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS031C11+ AGTGTCATATAAAG
JMSF039A24+ ATATTGGCATGGTTGGCAATATACTTAACAGCATCAGGACCAAGAGTGTCATATAAAG
                      ____________________________________________________________
consensus ATATTGGCATGGTTGGCAATATACTTAACAGCATCAGGACCAAGAGTGTCATATAAAG
 
. : . : . : . : . : . :
JMFS031C11+ GGACAGAGATAAATGAATATGCTGAGCAGGCATGGTCTACAATGAGCCATTCGGGCATAT
JMSF039A24+ GGACAGAGATAAATGAATATGCTGAGCAGGCATGGTCTACAATGAGCCATTCGGGCATAT
                      ____________________________________________________________
consensus GGACAGAGATAAATGAATATGCTGAGCAGGCATGGTCTACAATGAGCCATTCGGGCATAT
 
. : . : . : . : . : . :
JMFS031C11+ TTATGAAATAAATCCCCACGCGAGCTCCTGGTTCTAGTCCACAAAAACGAAGCCCAGAAC
JMSF039A24+ TTATGAAATAAATCCCCACGCGAGCTCCTGGTTCTAGTCCACAAAAACGAAGCCCAGAAC
                      ____________________________________________________________
consensus TTATGAAATAAATCCCCACGCGAGCTCCTGGTTCTAGTCCACAAAAACGAAGCCCAGAAC
 
. : . : . : . : . : . :
JMFS031C11+ CTATTGCTGACCGAGCTGTTCCAGCCTCTCCATATGTCATCCATTTGTATTCTCCAATGG
JMSF039A24+ CTATTGCTGACCGAGCTGTTCCAGCCTCTCCATATGTCATCCATTTGTATTCTCCAATGG
                      ____________________________________________________________
consensus CTATTGCTGACCGAGCTGTTCCAGCCTCTCCATATGTCATCCATTTGTATTCTCCAATGG
 
. : . : . : . : . : . :
JMFS031C11+ TTCCATCTACCCGTATACGTGTGCCCAAATATTTGTAATCTTGAAAGGTTTCAACTGCAT
JMSF039A24+ TTCCATCTACCCGTATACGTGTGCCCAAATATTTGTAATCTTGAAAGGTTTCAACTGCAT
                      ____________________________________________________________
consensus TTCCATCTACCCGTATACGTGTGCCCAAATATTTGTAATCTTGAAAGGTTTCAACTGCAT
 
. : . : . : . : . : . :
JMFS031C11+ GCACAAAGTTGTCATGCAGTGTACCAATATCAGGATGATCAGGGAATCTAGTTACAAGCT
JMSF039A24+ GCACAAAGTTGTCATGCAGTGTACCAATATCAGGATGATCAGGGAATCTAGTTACAAGCT
                      ____________________________________________________________
consensus GCACAAAGTTGTCATGCAGTGTACCAATATCAGGATGATCAGGGAATCTAGTTACAAGCT
 
. : . : . : . : . : . :
JMFS031C11+ TCAAAGGAGAGATCGCAGATCTGTATACATCCCACTTTCCAGTCTGCAATTTTTCAGGAA
JMSF039A24+ TCAAAGGAGAGATCGCAGATCTGTATACATCCCACTTTCCAGTCTGCAATTTTTCAGGAA
JMSF009C22+ GTCTGCAATTTTTCAGGAA
                      ____________________________________________________________
consensus TCAAAGGAGAGATCGCAGATCTGTATACATCCCACTTTCCAGTCTGCAATTTTTCAGGAA
 
. : . : . : . : . : . :
JMFS031C11+ GAACTACACTGTACCTTTGACCCTGAAAATATTCGCCGGCCGTGAGGTTTGAACGGATCA
JMSF039A24+ GAACTACACTGTACCTTTGACCCTGAAAATATTCGCCGGCCGTGAGGTTTGAACGGATCA
JMSF019D09+ ACACTGTACCTTTGACCCTGAAAATATTCGCCGGCCGTGAGGTTTGAACGGATCA
JMSF009C22+ GAACTACACTGTACCTTTGACCCTGAAAATATTCGCCGGCCGTGAGGTTTGAACGGATCA
                      ____________________________________________________________
consensus GAACTACACTGTACCTTTGACCCTGAAAATATTCGCCGGCCGTGAGGTTTGAACGGATCA
 
. : . : . : . : . : . :
JMFS031C11+ ATGAGAAGGAATCCCCGTCGGCGAGCGGAAGCAGGTGGCCTTGAATGGCTTTCAGGCGTC
JMSF039A24+ ATGAGAAGGAATCCCCGTCGGCGAGCGGAAGCAGGTGGCCTTGAATGGCTTTCAGGCGTC
JMSF019D09+ ATGAGAAGGAATCCCCGTCGGCGAGCGGAAGCAGGTGGCCTTGAATGGCTTTCAGGCGTC
JMSF009C22+ ATGAGAAGGAATCCCCGTCGGCGAGCGGAAGCAGGTGGCCTTGAATGGCTTTCAGGCGTC
                      ____________________________________________________________
consensus ATGAGAAGGAATCCCCGTCGGCGAGCGGAAGCAGGTGGCCTTGAATGGCTTTCAGGCGTC
 
. : . : . : . : . : . :
JMFS031C11+ GCTCGGCTGCCGGTTCCATTGACAATTCGGCTTTCTATTTTGTTGTAGAAAAGATAAATC
JMSF039A24+ GCTCGGCTGCCGGTTCCATTGACAATTCGGCTTTCTATTTTGTTGTAGAAAAGATAAATC
JMSF019D09+ GCTCGGCTGCCGGTTCCATTGACAATTCGGCTTTCTATTTTGTTGTAGGAAAGATAAATC
JMSF009C22+ GCTCGGCTGCCGGTTCCATTGACAATTCGGCTTTCTATTTTGTTGTAGAAAAGATAAATC
                      ____________________________________________________________
consensus GCTCGGCTGCCGGTTCCATTGACAATTCGGCTTTCTATTTTGTTGTAGAAAAGATAAATC
 
. : . : . : . : . : . :
JMFS031C11+ GAACTTGAAAGAAATTTTCTCCCAGAAAATCTAAACTT
JMSF039A24+ GAACTTGAAAGAAATTTTCTCCCAGAAAATCTAAACTTGAAATAC
JMSF019D09+ GAACTTGAAAGAAATTTTCTCCCAGAAAATCTAAACTTGAAATAC
JMSF009C22+ GAACTTGAAAGAAATTTTCTCCCAGAAAATCTAAACTTGAAATACAGACAAGAAAAGAGG
                      ____________________________________________________________
consensus GAACTTGAAAGAAATTTTCTCCCAGAAAATCTAAACTTGAAATACAGACAAGAAAAGAGG
 
. : . : . : . : . : . :
JMSF009C22+ CAATGAATATAGATATATATATTTAAAGAAAATGCGTGATGTATTAGTTTCCAATGCCCC
                      ____________________________________________________________
consensus CAATGAATATAGATATATATATTTAAAGAAAATGCGTGATGTATTAGTTTCCAATGCCCC