Previous Contig 005061:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041B03Sequence652005061 (2)gb:AB028617_15180190.007Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MOA2.610010104 (18)gb:AY846828_16307292e-62Triticum aestivum ribosomal protein L7 mRNA, complete cds.
JMSF009C21Sequence316005061 (2)517022307gb:CP000010_8664040.026Burkholderia mallei ATCC 23344 chromosome 1, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041B03+ ACTCCCATTTGATCNCGATGATAGGAAGAAGGAAAGAACTCCTTCGCCAATGG
                      ____________________________________________________________
consensus ACTCCCATTTGATCNCGATGATAGGAAGAAGGAAAGAACTCCTTCGCCAATGG
 
. : . : . : . : . : . :
JMFF041B03+ ATTCAATTTCAAAGTCTTCAACATATCAACCAGATCCTGCATTTGATACTCTGATTTCGA
                      ____________________________________________________________
consensus ATTCAATTTCAAAGTCTTCAACATATCAACCAGATCCTGCATTTGATACTCTGATTTCGA
 
. : . : . : . : . : . :
JMFF041B03+ GTTCAAGATCGAATTCGGATCAGAATTGGACCCCTTATCACCGTCTAACATGGATTCTGA
                      ____________________________________________________________
consensus GTTCAAGATCGAATTCGGATCAGAATTGGACCCCTTATCACCGTCTAACATGGATTCTGA
 
. : . : . : . : . : . :
JMFF041B03+ TTTCGCATTAGCGCTGAGATCAGAACCGGCATCGGAAATTTTGCCGGAATCGGCATAATT
                      ____________________________________________________________
consensus TTTCGCATTAGCGCTGAGATCAGAACCGGCATCGGAAATTTTGCCGGAATCGGCATAATT
 
. : . : . : . : . : . :
JMFF041B03+ GTCCGGTAACGAAGAAGAATTCTCTGTAGCAGTAGCCTTAACCACTGCTGCCTCACCAGA
                      ____________________________________________________________
consensus GTCCGGTAACGAAGAAGAATTCTCTGTAGCAGTAGCCTTAACCACTGCTGCCTCACCAGA
 
. : . : . : . : . : . :
JMFF041B03+ CACCTCCGCACCAGCAGCCATTAAATCAAACGCCAAAATACACTAAAAAGGGAAGTTTTT
JMSF009C21+ AAAAGGGAAGTTTTT
                      ____________________________________________________________
consensus CACCTCCGCACCAGCAGCCATTAAATCAAACGCCAAAATACACTAAAAAGGGAAGTTTTT
 
. : . : . : . : . : . :
JMFF041B03+ GTTTAAGAAATCACAACTCAGATGAATACCCTTTTATCAACCCCTCCAAAGACTCAATCT
JMSF009C21+ GTTTAAGAAATCACAACTCAGATGAATACCCTTTTATCAACCCCTCCAAAGACTCAATNT
                      ____________________________________________________________
consensus GTTTAAGAAATCACAACTCAGATGAATACCCTTTTATCAACCCCTCCAAAGACTCAATCT
 
. : . : . : . : . : . :
JMFF041B03+ TGATGATGCCAAAGATCAATGGCAAAAGAACAGCTTTCAGAATTGGGTAATCTCCATATT
JMSF009C21+ TGATGATGCCAAAGATCAATGGCAAAAGAACAGCTTTCAGAATTGGGTAATCTCCNTATT
                      ____________________________________________________________
consensus TGATGATGCCAAAGATCAATGGCAAAAGAACAGCTTTCAGAATTGGGTAATCTCCATATT
 
. : . : . : . : . : . :
JMFF041B03+ TATTTATTTATTTGAAAGGAAGAACTATATTTATTCTCTCACATAAATTGATAAAATTGT
JMSF009C21+ TATTTATTTATTTGAAAGGAAGAACTATATTTATTCTNTCNCNTAAATTGATAAAATTGT
                      ____________________________________________________________
consensus TATTTATTTATTTGAAAGGAAGAACTATATTTATTCTCTCACATAAATTGATAAAATTGT
 
. : . : . : . : . : . :
JMFF041B03+ TATGGAAAAAAAAAAAACTATAATAAATGCATTCCAAGTTGTGACAAATTTCTGGAAATG
JMSF009C21+ TATGG--AAAAAAAAAACTATAATAAATGCATTCCAAGTTGTGACAAATTTCTGGAAATG
                      ____________________________________________________________
consensus TATGGAAAAAAAAAAAACTATAATAAATGCATTCCAAGTTGTGACAAATTTCTGGAAATG
 
. : . : . : . : . : . :
JMFF041B03+ AAACAAGGAGATGGATAGGAGAGAGAATACGTAGACAGAGACTACTGAGTTTTTGT
JMSF009C21+ AAACAAGGAGATGGATAGGAGAGAGAATACGTAGACAGAGACTACTGAGTTTTTGTGACC
                      ____________________________________________________________
consensus AAACAAGGAGATGGATAGGAGAGAGAATACGTAGACAGAGACTACTGAGTTTTTGTGACC