Previous Contig 005058:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010M06Sequence524005058 (5)gb:ATAC009177_15428457e-29Arabidopsis thaliana chromosome III BAC T12H1 genomic sequence, complete sequenc614005058 (5)gb:ATAC009177_15428451e-28Arabidopsis thaliana chromosome III BAC T12H1 genomic sequence, complete sequenc
JMFN042A21Sequence624005058 (5)gb:ATAC009177_15428451e-31Arabidopsis thaliana chromosome III BAC T12H1 genomic sequence, complete sequenc
JMSF009C13Sequence312005058 (5)gb:ATAC009177_15428452e-10Arabidopsis thaliana chromosome III BAC T12H1 genomic sequence, complete sequenc545005058 (5)gb:ATAC009177_15428451e-31Arabidopsis thaliana chromosome III BAC T12H1 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010M06- ATAGATAAACATGACAATCTT
JMFN042A21+ TTCAAGATAATAGATAAACATGACAATCTT
                      ____________________________________________________________
consensus TTCAAGATAATAGATAAACATGACAATCTT
 
. : . : . : . : . : . :
rJMFF010M06- TAACACCAAATCACATCTCAAATCTTAATTTGATTAATTCATAATAAAACAAATTATGCA
JMFN042A21+ TAACACCAAATCACATCTCAAATCTTAATNTGATTAATTCATAATAAAACAAATTATGCA
rJMSF009C13- TATGCA
                      ____________________________________________________________
consensus TAACACCAAATCACATCTCAAATCTTAATTTGATTAATTCATAATAAAACAAATTATGCA
 
. : . : . : . : . : . :
rJMFF010M06- TAATCTCTAACGGTACAAAGCTACATAAGTAAAGGTTACACTTTGAAATCTCAAGAATTT
JMFF010M06+ ACGGTACAAAGCTACATAAGTAAAGGTTACACTTTGAAATCTCAAGAATTT
JMFN042A21+ TAATCTCTAACGGTACAAAGCTACATAAGTAAAGGTTACACTTTGAAATCTCAAGAATTT
rJMSF009C13- TAATCTCTAACGGTACAAAGCTACATAAGTAAAGGTTACACTTTGAAATCTCAAGAATTT
                      ____________________________________________________________
consensus TAATCTCTAACGGTACAAAGCTACATAAGTAAAGGTTACACTTTGAAATCTCAAGAATTT
 
. : . : . : . : . : . :
rJMFF010M06- GTGCCCAGATCTTCAGCCAATCTTCTCTTCTCTTCCTCCTCCCCTAGTTGATGCAGAGCC
JMFF010M06+ GTGCCCAGATCTTCAGCCAATCTTCTCTTCTCTTCCTCCTCCCCTAGTTGATGCAGAGCC
JMFN042A21+ GTGCCCAGATCTTCAGCCAATCTTCTCTTCTCTTCCTCCTCCCCTAGTTGATGCAGAGCC
rJMSF009C13- GTGCCCAGATCTTCAGCCAATCTTCTCTTCTCTTCCTCCTCCCCTAGTTGATGCAGAGCC
                      ____________________________________________________________
consensus GTGCCCAGATCTTCAGCCAATCTTCTCTTCTCTTCCTCCTCCCCTAGTTGATGCAGAGCC
 
. : . : . : . : . : . :
rJMFF010M06- TTGAGTGAGCGCTTCTCAAGCTTGTCAAGCCTCTTCTGTACGTCTCTCCTCAAGTCCCAA
JMFF010M06+ TTGAGTGAGCGCTTCTCAAGCTTGTCAAGCCTCTTCTGTACGTCTCTCCTCAAGTCCCAA
JMFN042A21+ TTGAGTGAGCGCTTCTCAAGCTTGTCAAGCCTCTTCTGTACGTCTCTCCTCAAGTCCCAA
rJMSF009C13- TTGAGTGAGCGCTTCTCAAGCTTGTCAAGCCTCTTCTGTACGTCTCTCCTCAAGTCCCAA
                      ____________________________________________________________
consensus TTGAGTGAGCGCTTCTCAAGCTTGTCAAGCCTCTTCTGTACGTCTCTCCTCAAGTCCCAA
 
. : . : . : . : . : . :
rJMFF010M06- TTCGGTTTTTTTGGGGGCAATATTCAAGAAGGGATCCTCATTTTTCTCCTTTTTGTCTTG
JMFF010M06+ TTCGGTTTTTTTGGGGGCAATATTCAAGAAGGGATCCTCATTTTTCTCCTTTTTGTCTTG
JMFN042A21+ TTCGG-TTTTTTGGGGGCAATATTCAAGAAGGGATCCTCATTTTTCTCCTTTTTGTCTTG
rJMSF009C13- TTCGG-TTTTTTGGGGGCAATATTCAAGAAGGGATCCTCATTTTTCTCCTTTTTGTCTTG
JMSF009C13+ CTTTTTGTCTTG
                      ____________________________________________________________
consensus TTCGGTTTTTTTGGGGGCAATATTCAAGAAGGGATCCTCATTTTTCTCCTTTTTGTCTTG
 
. : . : . : . : . : . :
rJMFF010M06- GGGTGGAGTTAGGTTTGCCATAGGGTCATCGAACTTGGGTAATACTGGAGGGGCAAGTTT
JMFF010M06+ GGGTGGAGTTAGGTTTGCCATAGGGTCATCGAACTTGGGTAATACTGGAGGGGCAAGTTT
JMFN042A21+ GGGTGGAGTTAGGTTTGCCATAGGGTCATCGAACTTGGGTAATACTGGAGGGGCAAGTTT
rJMSF009C13- GGGTGGAGTTAGGTTTGCCATAGGGTCATCGAACTTGGGTAATACTGGAGGGGCAAGTTT
JMSF009C13+ GGGTGGAGTTAGGTTTGCCATAGGGTCATCGAACTTGGGTAATACTGGAGGGGCAAGTTT
                      ____________________________________________________________
consensus GGGTGGAGTTAGGTTTGCCATAGGGTCATCGAACTTGGGTAATACTGGAGGGGCAAGTTT
 
. : . : . : . : . : . :
rJMFF010M06- ACCCTCCTGAAGGTGCTTGTCTTGAGGCAGATAATTTCGGAATTTCATTTGGAAATTCTC
JMFF010M06+ ACCCTCCTGAAGGTGCTTGTCTTGAGGCAGATAATTTCGGAATTTCATTTGGAAATTCTC
JMFN042A21+ ACCCTCCTGAAGGTGCTTGTCTTGAGGCAGATAATTTCGGAATTTCATTTGGAAATTCTC
rJMSF009C13- ACCCTCCTGAAGGTGCTTGTCTTGAGGCAGATAATTTCGGAATTTCATTTGGAAATTCTC
JMSF009C13+ ACCCTCCTGAAGGTGCTTGTCTTGAGGCAGATAATTTCGGAATTTCATTTGGAAATTCTC
                      ____________________________________________________________
consensus ACCCTCCTGAAGGTGCTTGTCTTGAGGCAGATAATTTCGGAATTTCATTTGGAAATTCTC
 
. : . : . : . : . : . :
rJMFF010M06- ATCATTTTCTTGTTGGTCTTGGCTAGCATCCTTATCATCGTCGGGGGTTTCGTGAAGCTC
JMFF010M06+ ATCATTTTCTTGTTGGTCTTGGCTAGCATCCTTATCATCGTCGGGGGTTTCGTGAAGCTC
JMFN042A21+ ATCATTTTCTTGTTGGTCTTGGCTAGCATCCTTATCATCGTCGGGGGTTTCGTGAAGCTC
rJMSF009C13- ATCATTTTCTTGTTGGTCTTGGCTAGCATCCTTATCATCGTCGGGGGTTTCGTGAAGCTC
JMSF009C13+ ATCATTTTCTTGTTGGTCTTGGCTAGCATCCTTATCATCGTCGGGGGTTTCGTGAAGCTC
                      ____________________________________________________________
consensus ATCATTTTCTTGTTGGTCTTGGCTAGCATCCTTATCATCGTCGGGGGTTTCGTGAAGCTC
 
. : . : . : . : . : . :
rJMFF010M06- TTGGGCAGCTCTGAGGGCCTTGAGCCGCTCCCTACGGGCTGCCGCCGCCGCCTCGACCGA
JMFF010M06+ TTGGGCAGCTCTGAGGGCCTTGAGCCGCTCCCTACGGGCTGCCGCCGCCGCCTCGACCGA
JMFN042A21+ TTGGGCAGCTCTGAGGGCCTTGAGCCGCTCCCTACGGGCTGCCGCCGCCGCCTCGACCGA
rJMSF009C13- TTGGGCAGCTCTGAGGGCCTTGAGCCGCTCCCTACGGGCTGCCGCCGCCGCCTCGACCGA
JMSF009C13+ TTGGGCAGCTCTGAGGGCCTTGAGCCGCTCCCTACGGGCTGCCGCCGCCGCCTCGACCGA
                      ____________________________________________________________
consensus TTGGGCAGCTCTGAGGGCCTTGAGCCGCTCCCTACGGGCTGCCGCCGCCGCCTCGACCGA
 
. : . : . : . : . : . :
rJMFF010M06- GCTTTCATCCTCAATTCCCATTCCAAAAAGCTTAATCCAGTAGAATACCGCAC
JMFF010M06+ GCTTTCATCCTCAATTCCCATTCCAAAAAGCTTAATCCAGTAGAATACCGCAC
JMFN042A21+ GCTTTCATCCTCAATTCCCATTCCAAAAAGCTTAATCCAGTAGAATACCGCAC
rJMSF009C13- GCTTTCATCCTCAATTCCCATTCCAAAAAGCTTAATCCAGTAGAATACCGCAC
JMSF009C13+ GCTTTCATCCTCAATTCCCATTCCAAAAAGCTTAATCCAGTAGAATACCGCACAGTCATC
                      ____________________________________________________________
consensus GCTTTCATCCTCAATTCCCATTCCAAAAAGCTTAATCCAGTAGAATACCGCACAGTCATC