Previous Contig 005042:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017D15Sequence545005042 (26)pir|B71400|B714001e-80glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3777005042 (26)gb:AY086929_15719672e-88Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMFF051B05Sequence581005042 (26)pir|B71400|B714008e-87glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3
JMFF051D18Sequence518005042 (26)pir|B71400|B714001e-74glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3
JMFS070D07Sequence626005042 (26)pir|B71400|B71400e-110glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3
JMFS087E07Sequence616005042 (26)pir|B71400|B714003e-94glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3
JMFS150C10Sequence453005042 (26)pir|B71400|B714006e-76glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3
JMSF001N04Sequence347005042 (26)gb:AY086929_15719673e-41Arabidopsis thaliana clone 29662 mRNA, complete sequence.650005042 (26)gb:AY086929_15719675e-72Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF008P05Sequence316005042 (26)gb:AY086929_15719673e-37Arabidopsis thaliana clone 29662 mRNA, complete sequence.775005042 (26)gb:AY086929_15719671e-84Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF016K16Sequence496005042 (26)gb:AY086929_15719671e-70Arabidopsis thaliana clone 29662 mRNA, complete sequence.735005042 (26)gb:AY086929_15719674e-90Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF024C15Sequence651005042 (26)pir|B71400|B71400e-100glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3786005042 (26)gb:AY086929_1571967e-100Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF032I16Sequence653005042 (26)pir|B71400|B71400e-101glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3715005042 (26)gb:AY086929_15719671e-74Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF032J15Sequence449005042 (26)gb:AY086929_15719673e-25Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF033D08Sequence650005042 (26)pir|B71400|B71400e-100glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3717005042 (26)gb:AY086929_15719672e-75Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF037C19Sequence609005042 (26)pir|B71400|B714002e-91glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3751005042 (26)gb:AY086929_15719673e-80Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF038N04Sequence616005042 (26)pir|B71400|B71400e-102glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3848001181 (25)gb:AF531363_18093063e-62Gossypium barbadense fiber protein Fb2 mRNA, complete cds.
JMSF040J16Sequence605005042 (26)pir|B71400|B714008e-91glycine hydroxymethyltransferase (EC 2.1.2.1) - Arabidopsis thaliana>gb:ATCHRIV3796005042 (26)gb:AY086929_1571967e-115Arabidopsis thaliana clone 29662 mRNA, complete sequence.
JMSF045J21Sequence761009485 (8)gb:AJ843984_18146763e-28Plantago major mRNA for hypothetical protein.715005042 (26)gb:AY086929_15719672e-72Arabidopsis thaliana clone 29662 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037C19- AAATAGTATGAATTACAAAATCATTTGAGACATGGAAATCATTTCAAAG
rJMSF033D08- AAATAGTATGAATTACAAAATCATTTGAGACATGGAAATCATTTCAAAG
rJMSF045J21- AAATAGTATGAATTACAAAATCATTTGAGACATGGAAATCATTTCAAAG
rJMSF001N04- G
rJMSF032J15- CATTTGAGACNTGGAAATCATTTCAAAG
rJMSF032I16- AAATAGTATGAATTACAAAATCATTTGAGACATGGAAATCATTTCAAAG
rJMSF008P05- AAATAGTATGAATTACAAAATCATTTGAGACATGGAAATCATTTCAAAG
rJMFF017D15- TGGAAATCATTTCAAAG
                      ____________________________________________________________
consensus AAATAGTATGAATTACAAAATCATTTGAGACATGGAAATCATTTCAAAG
 
. : . : . : . : . : . :
rJMSF037C19- TTTTATCAACTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMSF033D08- TTTTATCAACTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMSF045J21- TTTTATCAACTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMSF001N04- TTTTATCAACTTTGGGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMSF032J15- NTTNATCANCTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAANATCC
rJMSF032I16- TTTTATCAACTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMSF008P05- TTTTATCAACTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMSF016K16- ACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMFF017D15- TTTTATCAACTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
rJMSF024C15- AGTTCATGCGACAATTTAAACACTAAAATCC
                      ____________________________________________________________
consensus TTTTATCAACTTT-GGAGCAACTCCTACAAGTTCATGCGACAATTTAAACACTAAAATCC
 
. : . : . : . : . : . :
rJMSF037C19- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMSF033D08- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMSF045J21- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMSF001N04- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMSF032J15- TAAAACACCAAGTAGAGAANGANACAGAGACAACATTNTTGTTCTTCAGCATAAGCCATG
rJMSF032I16- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMSF008P05- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMSF016K16- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMFF017D15- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
rJMSF024C15- TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
                      ____________________________________________________________
consensus TAAAACACCAAGTAGAGAATGATACAGAGACAACATTATTGTTCTTCAGCATAAGCCATG
 
. : . : . : . : . : . :
rJMSF037C19- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF033D08- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF045J21- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF001N04- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF032J15- AATTGAATTAACNCAAGGGAAATTCTCAAATNCGNATTGGAGCNTATGATGCATACATAA
rJMSF032I16- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF008P05- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF016K16- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMFF017D15- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF024C15- AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
rJMSF040J16- AATTCTCANATTCGTATTGGAGCATATGATGCATACATAA
                      ____________________________________________________________
consensus AATTGAATTAACACAAGGGAAATTCTCAAATTCGTATTGGAGCATATGATGCATACATAA
 
. : . : . : . : . : . :
rJMSF037C19- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF033D08- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF045J21- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF001N04- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF032J15- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF032I16- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF008P05- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF016K16- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMFF017D15- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF024C15- GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
rJMSF040J16- GGAAAATGTTGCCTAGATCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
                      ____________________________________________________________
consensus GGAAAATGTTGCCTAG-TCCTGGTACTTCATTTCGGATGTTTTGAAGCCGGGCATGTCAA
 
. : . : . : . : . : . :
rJMSF037C19- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF033D08- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF045J21- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF001N04- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF032J15- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF032I16- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF008P05- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF016K16- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMFF017D15- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF024C15- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
rJMSF040J16- AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
                      ____________________________________________________________
consensus AGGAGGCCGAGAACTTCTCAACATCGGCCTTGAGCTGCTCGATTTCCTTGTTGTTAACGA
 
. : . : . : . : . : . :
rJMSF037C19- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF033D08- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF045J21- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF001N04- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF032J15- GACCCTTGTTGAANTCCTTCAANAATTTCCCGTGCTCCTTTTGGATGCTCAAGGNGAGGG
rJMSF032I16- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF008P05- GACCCTTGTTGAAGTCCTTCAAGAGTTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF016K16- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMFF017D15- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF024C15- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
rJMSF040J16- GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
                      ____________________________________________________________
consensus GACCCTTGTTGAAGTCCTTCAAGAATTTCCCGTGCTCCTTTTGGATGCTCAAGGTGAGGG
 
. : . : . : . : . : . :
rJMSF037C19- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF033D08- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF045J21- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF001N04- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF032J15- TCACAGCCCTGTGGAGGAACNCGGCCANCTGCTCNAAGTCCTTCTCGACCAAACCCCTTG
rJMSF032I16- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF008P05- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF016K16- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMFF017D15- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF024C15- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
rJMSF040J16- TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
                      ____________________________________________________________
consensus TCACAGCCCTGTGGAGGAACTCGGCAATCTGCTCAAAGTCCTTCTCGACCAAACCCCTTG
 
. : . : . : . : . : . :
rJMSF037C19- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF033D08- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF045J21- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF001N04- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF032J15- ATG
rJMSF032I16- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF008P05- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF016K16- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMFF017D15- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF024C15- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
rJMSF040J16- ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
                      ____________________________________________________________
consensus ATGTCATGGCAGGAGCACCAATGCGAACTCCTCCAGGGGCAAGAGCGCTACTGTCACCAA
 
. : . : . : . : . : . :
rJMSF037C19- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMSF033D08- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMSF045J21- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMSF001N04- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMSF032I16- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMSF008P05- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMSF016K16- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMFF017D15- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
rJMSF024C15- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGAACTTGTTAC
rJMSF040J16- ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
                      ____________________________________________________________
consensus ATACAGCGTTCTTGTTCACGGTAATGTTGCACAGGTCACAGAGTTTCTCGACCTTGTTAC
 
. : . : . : . : . : . :
rJMSF037C19- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF033D08- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF045J21- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF001N04- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF032I16- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF008P05- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF016K16- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMFF017D15- CAGTAAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF024C15- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
rJMSF040J16- CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
                      ____________________________________________________________
consensus CAGTCAAACCAAGAGGACGAAGGTCCCATAGAACAAGGTGGTTCTCAGTCCCATCAGTGA
 
. : . : . : . : . : . :
rJMSF037C19- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
rJMSF033D08- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
rJMSF045J21- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGGCCCCGGACT
rJMSF001N04- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTG
rJMSF032I16- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
rJMSF008P05- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
rJMSF016K16- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
rJMFF017D15- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
rJMSF024C15- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
rJMSF040J16- CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCNAGCGCAACTGCATTGG-CCCGGACT
                      ____________________________________________________________
consensus CGAGCTTGTACCCTTTGTTCATCAAGTAGTTGCCGAGCGCAACTGCATTGG-CCCGGACT
 
. : . : . : . : . : . :
rJMSF037C19- TGCTTAGCATAGGCCTTAAAGCCCGGAGACGCGGCCTGCTTTAGG
rJMSF033D08- TGCTTAGCATA
rJMSF045J21- TGCTTAGC
rJMSF032I16- TGCTTAGCA
rJMSF008P05- TGCTTAGCATAGGCCTTAAAGCCCGGAGACGCGGCCTGCTTTAGGGCAACAGCCAAAGCA
rJMSF016K16- TGCTTAGCATAGGCCTTAAAGCCCGGAGACGCGGCCTGCTTTAGGGCAACAGCCAAAGCA
rJMFF017D15- TGCTTAGCATAGGCCTTAAAGCCCGGAGACGCGGCCTGCTTTANGGCAACAGCCAAAGCA
rJMSF024C15- TGCTTAGCATAGGCCTTAAAGCCCGGAGACGCGGCCTGCTTTAGGGCAACAGCCAAAGCA
rJMSF040J16- TGCTTAGCATAGGCCTTAAAGCCCGGAGACGCGGCCTGCTTTAGGGCAACAGCCAAAGCA
                      ____________________________________________________________
consensus TGCTTAGCATAGGCCTTAAAGCCCGGAGACGCGGCCTGCTTTAGGGCAACAGCCAAAGCA
 
. : . : . : . : . : . :
rJMSF008P05- CCAATTTGG
rJMSF016K16- CCAATTTGGTGATTGTGGGGACCGCCTTGCA
rJMFF017D15- CCAATTTGGTGATTGTGGGGACCGCCTTGCA
rJMSF024C15- CCAATTTGGTGATTGTGGGGACCGCCTTGCAGAGATGGGAAAACCGCAAAGTTGATCTTG
rJMSF040J16- CCAATTTGGTGATTGTGGGGACCGCCTTGCAGAGATGGGAAAACCGCAAAGTTGATCTTG
                      ____________________________________________________________
consensus CCAATTTGGTGATTGTGGGGACCGCCTTGCAGAGATGGGAAAACCGCAAAGTTGATCTTG
 
. : . : . : . : . : . :
rJMSF024C15- TCTTCAAAGTCATACACTGCACCCTCC
rJMSF040J16- TCTTCAAAGTCATACACTGCACCCTCCGGTTGTCCCTTCTTCGGTGGCTTGGGGNCCTTG
JMFS070D07+ GGGGCCCTTG
                      ____________________________________________________________
consensus TCTTCAAAGTCATACACTGCACCCTCCGGTTGTCCCTTCTTCGGTGGCTTGGGGCCCTTG
 
. : . : . : . : . : . :
rJMSF040J16- CGGT-AAAAATCATACCAGCCCTAGGCCCCCTCAAGCTCTTGTGAGTTGTGGTGGTGACA
JMFS070D07+ CGGTAAAAAATCATACCAGCCCTAGGCCCCCTCAAGCTCTTGTGAGTTGTGGTGGTGACA
                      ____________________________________________________________
consensus CGGTAAAAAATCATACCAGCCCTAGGCCCCCTCAAGCTCTTGTGAGTTGTGGTGGTGACA
 
. : . : . : . : . : . :
rJMSF040J16- ATATCACAGTACTCAAAAGGATCAGCTGCTTCC
JMFS070D07+ ATATCACAGTACTCAAAAGGATCAGCTGCTTCCTGAGCGGCAACGAGGCCACTAATGTGA
                      ____________________________________________________________
consensus ATATCACAGTACTCAAAAGGATCAGCTGCTTCCTGAGCGGCAACGAGGCCACTAATGTGA
 
. : . : . : . : . : . :
JMFS070D07+ GCCATATCGCAGAGCAAAAGCGCCCCACATTTATCAGCAATCTCTCTGAATCTCTTGTAG
                      ____________________________________________________________
consensus GCCATATCGCAGAGCAAAAGCGCCCCACATTTATCAGCAATCTCTCTGAATCTCTTGTAG
 
. : . : . : . : . : . :
JMFS070D07+ TCCCAATCTCTAGGGTAAGCACTGCCACCACAGATGATCAACTTCGGCCTGAAATCCAGG
JMSF038N04+ CTCTAGGGTAAGCACTGCCACCACAGATGATCAACTTCGGCCTGAAATCCAGG
JMSF032I16+ CTCTAGGGTAAGCACTGCCACCACAGATGATCAACTTCGGCCTGAAATCCAGG
JMSF033D08+ CTCTAGGGTAAGCACTGCCACCACAGATGATCAACTTCGGCCTGAAATCCAGG
JMFS087E07+ ATGATCAACTTCGGCCTGAAATCCAGG
JMSF040J16+ ATCCAGG
JMSF037C19+ TGAAATCCAGG
JMSF024C15+ CTCTAGGGTAAGCACTGCCACCACAGATGATCAACTTCGGCCTGAAATCCAGG
                      ____________________________________________________________
consensus TCCCAATCTCTAGGGTAAGCACTGCCACCACAGATGATCAACTTCGGCCTGAAATCCAGG
 
. : . : . : . : . : . :
JMFS070D07+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMSF038N04+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMSF032I16+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMSF033D08+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMFS150C10+ TCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMFS087E07+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMSF040J16+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMSF037C19+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMFF051B05+ TATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
JMFF017D15+ TGTACGGC
JMSF024C15+ GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
                      ____________________________________________________________
consensus GCCTTCTCCTCCAATCTATCGTAATCGATGTACCCGGTGGCGGAATTCACCTTGTACGGC
 
. : . : . : . : . : . :
JMFS070D07+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMSF038N04+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMSF032I16+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMSF033D08+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMFS150C10+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMFS087E07+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMSF040J16+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMSF037C19+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMFF051B05+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMFF051D18+ AGGTAGCGGAGATCTTCTCCCCGCCGGAAGTATAGTACCCG
JMSF016K16+ CCGGAAGTATAGTACCCG
JMFF017D15+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
JMSF024C15+ AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
                      ____________________________________________________________
consensus AAGCTCTCGAAGTAAATCGAGGTAGCGGAGATCTTCTTCCCGCCGGAAGTATAGTACCCG
 
. : . : . : . : . : . :
JMFS070D07+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMSF038N04+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMSF032I16+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMSF033D08+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMFS150C10+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMFS087E07+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMSF040J16+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMSF037C19+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMFF051B05+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMFF051D18+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMSF016K16+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMFF017D15+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
JMSF024C15+ TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
                      ____________________________________________________________
consensus TGAGTCAAATGCCCGCCGGAGGGCAAATCCAGCCCCATGATCCGGTCATGCGGGTTGAGC
 
. : . : . : . : . : . :
JMFS070D07+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMSF038N04+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMSF032I16+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMSF033D08+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMFS150C10+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMFS087E07+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMSF040J16+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMSF037C19+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMFF051B05+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMFF051D18+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMSF016K16+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMFF017D15+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
JMSF024C15+ ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
                      ____________________________________________________________
consensus ACCGCCGTGTAGGCGGCGAAGTTGGCGGGGCTGCCGGAGTAGGGCTGCACGTTGACGCCC
 
. : . : . : . : . : . :
JMFS070D07+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF038N04+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTACGGGTGAGGTTCTCGATT
JMSF032I16+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF033D08+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMFS150C10+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMFS087E07+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF040J16+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF037C19+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMFF051B05+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMFF051D18+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF016K16+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMFF017D15+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF024C15+ CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF001N04+ GTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
JMSF008P05+ TGAGGTTCTCGATT
                      ____________________________________________________________
consensus CACTTGGTGGGGTCCAGGCGGTAGGCCTGGAGCGCGCGGCTGCGGGTGAGGTTCTCGATT
 
. : . : . : . : . : . :
JMFS070D07+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF038N04+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF032I16+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF033D08+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMFS150C10+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMFS087E07+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF040J16+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF037C19+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMFF051B05+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMFF051D18+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF016K16+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMFF017D15+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF024C15+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF001N04+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
JMSF008P05+ TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
                      ____________________________________________________________
consensus TCGTCGATGTACTCGTTGCCGCCGTAGTAGCGGTTCCCCGGCATGCCCTCGGAGTACTTG
 
. : . : . : . : . : . :
JMFS070D07+ TTGGTGAGGGCG
JMSF038N04+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF032I16+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF033D08+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMFS150C10+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMFS087E07+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF040J16+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF037C19+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMFF051B05+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMFF051D18+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF016K16+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMFF017D15+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF024C15+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF001N04+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
JMSF008P05+ TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
                      ____________________________________________________________
consensus TTGGTGAGGGCGCTGCCGAGGGCCTCGATGACGGCGAAGGAGGTGAAATTCTCCGAGGCG
 
. : . : . : . : . : . :
JMSF038N04+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF032I16+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF033D08+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMFS150C10+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTC
JMFS087E07+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF040J16+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF037C19+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMFF051B05+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMFF051D18+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF016K16+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMFF017D15+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF024C15+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF001N04+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
JMSF008P05+ ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
                      ____________________________________________________________
consensus ATCAGCTCGATCCCCCGGCACTGGCGCCGCTTCTCCTTCTCGATTAGGTCGTGGATCTCC
 
. : . : . : . : . : . :
JMSF038N04+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF032I16+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF033D08+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMFS087E07+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF040J16+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF037C19+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMFF051B05+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMFF051D18+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF016K16+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMFF017D15+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF024C15+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF001N04+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
JMSF008P05+ GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
                      ____________________________________________________________
consensus GGGTCCACCACGGCGAGCGGAGTGTTTCCCCATTCTGAGACGGGATCCATGGCGGCGGGT
 
. : . : . : . : . : . :
JMSF038N04+ TTGGAGGGGTTTAGGCT
JMSF032I16+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGCC
JMSF033D08+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGC
JMFS087E07+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAG
JMSF040J16+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGCC
JMSF037C19+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAG
JMFF051B05+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGC
JMFF051D18+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAG
JMSF016K16+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGC
JMFF017D15+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGC
JMSF024C15+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGCC
JMSF001N04+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGCC
JMSF008P05+ TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGCCTC
                      ____________________________________________________________
consensus TTGGAGGGGTTTAGGCTGGAAAATGAGTCAGAGAAGAGTGGAGATTGAGAGTAGCGCCTC