Previous Contig 005040:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006D15Sequence602005040 (26)gb:CS3KCT_16737968e-85C.sativus mRNA for 3-ketoacyl-CoA thiolase.802005040 (26)pir|T52110|T521108e-94acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMFF009D02Sequence569005040 (26)pir|S72532|S725325e-71acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor - cucurbit>gb:D70895_167474709005040 (26)pir|T52110|T521104e-83acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMFF024B23Sequence568005040 (26)pir|S72532|S725322e-70acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor - cucurbit>gb:D70895_167474801005040 (26)pir|T52110|T521101e-97acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMFF024E12Sequence517005040 (26)gb:AY058176_15643123e-66Arabidopsis thaliana At2g33150/F25I18.11 mRNA, complete cds.788005040 (26)pir|T52110|T521104e-95acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMFF028G19Sequence527005040 (26)gb:AY058176_15643125e-60Arabidopsis thaliana At2g33150/F25I18.11 mRNA, complete cds.668005040 (26)pir|T52110|T521102e-79acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMFF035A23Sequence571005040 (26)pir|S72532|S725325e-71acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor - cucurbit>gb:D70895_167474616005040 (26)pir|T52110|T521106e-70acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMFF045K07Sequence637005040 (26)gb:CS3KCT_16737961e-81C.sativus mRNA for 3-ketoacyl-CoA thiolase.638005040 (26)pir|T07989|T079893e-58acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - rape>gb:BNGB
JMFN029I21Sequence474005040 (26)pir|T07989|T079892e-30acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - rape>gb:BNGB
JMFS138C10Sequence624005040 (26)gb:MITHMF5_16866034e-84M.indica (Manila) THMF5 mRNA for 3-ketoacyl-coA thiolase B.
JMSF008O20Sequence247005040 (26)gb:AY308827_15978494e-09Helianthus annuus acetoacetyl CoA thiolase mRNA, complete cds.789005040 (26)pir|T52110|T521103e-94acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMSF015C16Sequence509005040 (26)gb:AY058176_15643125e-65Arabidopsis thaliana At2g33150/F25I18.11 mRNA, complete cds.815005040 (26)pir|T52110|T52110e-104acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMSF017C07Sequence426005040 (26)gb:AY058176_15643121e-50Arabidopsis thaliana At2g33150/F25I18.11 mRNA, complete cds.766005040 (26)pir|T52110|T521103e-94acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMSF039A12Sequence677005040 (26)gb:CS3KCT_16737961e-86C.sativus mRNA for 3-ketoacyl-CoA thiolase.867005040 (26)pir|T52110|T52110e-106acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis
JMSF044N15Sequence753005040 (26)gb:MITHMF5_16866033e-92M.indica (Manila) THMF5 mRNA for 3-ketoacyl-coA thiolase B.709005040 (26)pir|T52110|T521101e-83acetyl-CoA C-acyltransferase (EC 2.3.1.16) precursor, glyoxysomal - Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045K07- ACCCTGGAGAGTTTTTTTTTTT
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTTTT
 
. : . : . : . : . : . :
JMFN029I21+ GTAATAAACTAATTATAAATATATTTCAACACTCAGGATTACACAAGTTCTCATT
rJMFF045K07- TTTTTGTAATAAACTAATTATAAATATATTTCAACACTCAGGATTACACAAGTTCTCATT
rJMFF024E12- TCTT
rJMFF024B23- TCTT
rJMFF006D15- TCTT
rJMSF017C07- GTTCTCATT
rJMSF044N15- TTCTCATT
rJMSF008O20- GTTCTCATT
rJMFF009D02- TCTT
rJMSF039A12- GATTACACAAGTTCTCATT
                      ____________________________________________________________
consensus TTTTTGTAATAAACTAATTATAAATATATTTCAACACTCAGGATTACACAAGTTCTCATT
 
. : . : . : . : . : . :
JMFN029I21+ GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMFF045K07- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMSF015C16- TTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMFF024E12- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMFF024B23- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMFF006D15- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMSF017C07- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMSF044N15- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMFF028G19- TTAAAGTCTGGGAATTTGTAATCCAAT
rJMSF008O20- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMFF035A23- TATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMFF009D02- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
rJMSF039A12- GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
                      ____________________________________________________________
consensus GATTATTATGCTGCTACAATTACTTGATATTAATTAAAGTCTGGGAATTTGTAATCCAAT
 
. : . : . : . : . : . :
JMFN029I21+ CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMFF045K07- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMSF015C16- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMFF024E12- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMFF024B23- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMFF006D15- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMSF017C07- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMSF044N15- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMFF028G19- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMSF008O20- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMFF035A23- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMFF009D02- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
rJMSF039A12- CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
                      ____________________________________________________________
consensus CATACAATTGAAGTGCCACAGTAAAAACTTCCCTACTACCCTTAAAAATTTAACTTATTG
 
. : . : . : . : . : . :
JMFN029I21+ ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMFF045K07- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMSF015C16- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMFF024E12- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMFF024B23- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMFF006D15- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMSF017C07- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMSF044N15- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMFF028G19- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMSF008O20- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMFF035A23- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMFF009D02- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
rJMSF039A12- ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
                      ____________________________________________________________
consensus ATGTCACTGCTTCCCACTTCATAAATTATTGATGAAACCAAGAGATTTATACACCATGAG
 
. : . : . : . : . : . :
JMFN029I21+ AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMFF045K07- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMSF015C16- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMFF024E12- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMFF024B23- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMFF006D15- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMSF017C07- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMSF044N15- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMFF028G19- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMSF008O20- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMFF035A23- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMFF009D02- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
rJMSF039A12- AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
                      ____________________________________________________________
consensus AGGTCTACCGAGCATCCTTAGACAAGTAGCCATGAGTTTCGACTTTTCGGGCATTGCTGA
 
. : . : . : . : . : . :
JMFN029I21+ GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMFF045K07- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMSF015C16- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMFF024E12- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMFF024B23- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMFF006D15- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMSF017C07- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMSF044N15- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMFF028G19- GCTCATCACAAGCATCGCCTCTCTC-AAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMSF008O20- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMFF035A23- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMFF009D02- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
rJMSF039A12- GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
                      ____________________________________________________________
consensus GCTCATCACAAGCATCGCCTCTCTCAAAAACACCCGCAGCACCCATTCCCGTGCCTATGC
 
. : . : . : . : . : . :
JMFN029I21+ ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMFF045K07- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMSF015C16- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMFF024E12- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMFF024B23- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMFF006D15- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMSF017C07- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMSF044N15- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMFF028G19- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMSF008O20- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMFF035A23- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMFF009D02- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
rJMSF039A12- ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
                      ____________________________________________________________
consensus ACATGGAAACCACACCATAGCGGCAGTCTTTGCCACGACGCTTCATCTCATGCAACAAAG
 
. : . : . : . : . : . :
JMFN029I21+ TTGCAACACACCGAGCTCCTG-TGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMFF045K07- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMSF015C16- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMFF024E12- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGAATGACCAATAGCCATGGCACCTCCAT
rJMFF024B23- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGAATGACCAATAGCCATGGCACCTCCAT
rJMFF006D15- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMSF017C07- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMSF044N15- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMFF028G19- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMSF008O20- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
rJMFF035A23- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGAATGACCAATAGCCATGGCACCTCCAT
rJMFF009D02- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGAATGACCAATAGCCATGGCACCTCCAT
rJMSF039A12- TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
                      ____________________________________________________________
consensus TTGCAACACACCGAGCTCCTGTTGCACCCAAAGGATGACCAATAGCCATGGCACCTCCAT
 
. : . : . : . : . : . :
rJMFF045K07- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMSF015C16- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMFF024E12- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMFF024B23- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMFF006D15- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMSF017C07- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMSF044N15- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMFF028G19- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMSF008O20- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMFF035A23- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMFF009D02- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
rJMSF039A12- TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
                      ____________________________________________________________
consensus TTACATTGATCTTCTCTGGATCAAGTCCCAGCTTCTTTTGGCAGTATAAATACTGTGATG
 
. : . : . : . : . : . :
rJMFF045K07- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMSF015C16- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMFF024E12- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMFF024B23- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMFF006D15- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMSF017C07- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMSF044N15- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMFF028G19- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMSF008O20- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMFF035A23- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMFF009D02- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
rJMSF039A12- CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
                      ____________________________________________________________
consensus CAAATGCTTCATTGATCTCAAAAAGATCGATATCATCCAGTTCAAGTCCAGCAGATTTAA
 
. : . : . : . : . : . :
rJMFF045K07- CAGCTGCCGGAATTGC
rJMSF015C16- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMFF024E12- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMFF024B23- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMFF006D15- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMSF017C07- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMSF044N15- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMFF028G19- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMSF008O20- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMFF035A23- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMFF009D02- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
rJMSF039A12- CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
                      ____________________________________________________________
consensus CAGCTGCCGGAATTGCCACGGCTGGACCAATGCCCATTACAGCAGGATCTACACCAACCG
 
. : . : . : . : . : . :
rJMSF015C16- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMFF024E12- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMFF024B23- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMFF006D15- CAGCAAAAGTCCTGAATACACCAAGGGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMSF017C07- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMSF044N15- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMFF028G19- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMSF008O20- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMFF035A23- CAGCAAAAGTCCTGAATACACC
rJMFF009D02- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
rJMSF039A12- CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
                      ____________________________________________________________
consensus CAGCAAAAGTCCTGAATACACCAA-GGATTGGAAGTCCTTTCTGGATTGCAAGACTCCTC
 
. : . : . : . : . : . :
rJMSF015C16- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
rJMFF024E12- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
rJMFF024B23- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
rJMFF006D15- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
rJMSF017C07- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
rJMSF044N15- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTA
rJMFF028G19- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAG
rJMSF008O20- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
rJMFF009D02- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAG
rJMSF039A12- TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
JMFS138C10+ ACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
                      ____________________________________________________________
consensus TTCATAAGCAGTACAGCACCAGCCCCATCAGTAACTTGACTAGAGTTTCCAGCAGTGGTG
 
. : . : . : . : . : . :
rJMSF015C16- GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCCAATACTTGCATTTGGA
rJMFF024E12- GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCCNATACTTGCATTTGGA
rJMFF024B23- GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCCNATACTTGCATTTGGA
rJMFF006D15- GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCCAATACTTGCATTTGGA
rJMSF017C07- GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAG
rJMSF008O20- GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCC-ATACTTGCATTTGGA
rJMSF039A12- GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCCAATACTTGCATTTGGA
JMFS138C10+ GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCCAATACTTGCATTTGGA
                      ____________________________________________________________
consensus GTCCCATCTTTCTTGAACACAGGTTTCAACTTTGCCAGGTCTCCAATACTTGCATTTGGA
 
. : . : . : . : . : . :
rJMSF015C16- CGAATCCCATCATCAACAGAGATNGTCACGGTAGTCTCATCTCC-GNTTTTGGGTTAACA
rJMFF024E12- CGAAT
rJMFF024B23- CGAATCCCATCATCAAC
rJMFF006D15- CGAATCCCATCATCAAC
rJMSF008O20- CG
rJMSF039A12- CGAATCCCATCATCAACAGAGATTGTCACGGTAGTCTCATCTCCAGTTTTTGGGTTAACA
JMFS138C10+ CGAATCCCATCATCAACAGAGATTGTCACGGTAGTCTCATCTCCAGTTTTTGGGTTAACA
                      ____________________________________________________________
consensus CGAATCCCATCATCAACAGAGATTGTCACGGTAGTCTCATCTCCAGTTTTTGGGTTAACA
 
. : . : . : . : . : . :
rJMSF039A12- ATCTTTGTT
JMFS138C10+ ATCTTTGTTGTCACAGGTATTATTTCATCTTTGAACTTTCCAGCAGCAGTTGCAGCAGCA
JMSF044N15+ CCAGCAGCAGTTGCAGCAGCA
                      ____________________________________________________________
consensus ATCTTTGTTGTCACAGGTATTATTTCATCTTTGAACTTTCCAGCAGCAGTTGCAGCAGCA
 
. : . : . : . : . : . :
JMFS138C10+ GCCTTCCTATGTGACTCAACAGCTGCCTGATCTTGTTCTTGCCTTGTCACACCAAAGCGA
JMSF039A12+ AAGCGA
JMSF044N15+ GCCTTCNTATGTGACTCAACAGCTGCCTGATCTTGTTCTTGCCTTGTCACACCAAAGCGA
                      ____________________________________________________________
consensus GCCTTCCTATGTGACTCAACAGCTGCCTGATCTTGTTCTTGCCTTGTCACACCAAAGCGA
 
. : . : . : . : . : . :
JMFS138C10+ TGTGCAACATTTTCAGAAGTAATACCCATGGGAAGAAGACAGTTTTGAGCTTGCTGTAAT
JMFF045K07+ CATGGGAAGAAGACAGTTTTGAGCTTGCTGTAAT
JMFF006D15+ CATTTTCAGAAGTAATACCCATGGGAAGAAGACAGTTTTGAGCTTGCTGTAAT
JMSF039A12+ TGTGCAACATTTTCAGAAGTAATACCCATGGGAAGAAGACAGTTTTGAGCTTGCTGTAAT
JMSF044N15+ TGTGCAACATTTTCAGAAGTAATACCCATGGGAAGAAGACAGTTTTGAGCTTGCTGTAAT
                      ____________________________________________________________
consensus TGTGCAACATTTTCAGAAGTAATACCCATGGGAAGAAGACAGTTTTGAGCTTGCTGTAAT
 
. : . : . : . : . : . :
JMFS138C10+ GTACTAGCTCTAGGATTGACTGAGCCTTCCTCTGCCATGGTGTTTACAGTCATAGACTCC
JMFF045K07+ CTACTAGCTCTAGGATTGACTGAGCCTTCCCATGCCATGGTGTTTACAGTCATAGACTCC
JMFF006D15+ GTACTAGCTCTAGGATTGACTGAGCCTTCCCATGCCATGGTGTTTACAGTCATAGACTCC
JMSF039A12+ GTACTAGCTCTAGGATTGACTGAGCCTTCCCATGCCATGGTGTTTACAGTCATAGACTCC
JMFF024B23+ TTTACAGTCATAGACTCC
JMFF009D02+ GTTTACAGTCATAGACTCC
JMFF035A23+ GTGTTTACAGTCATAGACTCC
JMSF044N15+ GTACTAGCTCTAGGATTGACTGAGCCTTCCCATGCCATGGTGTTTACAGTCATAGACTCC
                      ____________________________________________________________
consensus GTACTAGCTCTAGGATTGACTGAGCCTTCCCATGCCATGGTGTTTACAGTCATAGACTCC
 
. : . : . : . : . : . :
JMFS138C10+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
JMFF045K07+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
JMFF006D15+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
JMSF015C16+ ATAGCTGCAGCAACATCTGCA
JMSF039A12+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
JMFF024B23+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
JMFF024E12+ GCTTTGATAGCTGCAGCAACATCTGCA
JMFF009D02+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
JMFF035A23+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
JMSF044N15+ AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
                      ____________________________________________________________
consensus AAGCCAGCCCCAATGCCTATGTCATAAAATCCAGCTTTGATAGCTGCAGCAACATCTGCA
 
. : . : . : . : . : . :
JMFS138C10+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMFF045K07+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMFF006D15+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMSF015C16+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMSF039A12+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMFF024B23+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMFF024E12+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMFF009D02+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMFF035A23+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMSF044N15+ ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
JMFF028G19+ GACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
                      ____________________________________________________________
consensus ACTGCTTGGAGACCAGAAGAGCATTGCCTGTTCACAGTTCTAACTGGAACAGTTTCAGGA
 
. : . : . : . : . : . :
JMFS138C10+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMFF045K07+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMFF006D15+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMSF015C16+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMSF039A12+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMFF024B23+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMFF024E12+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMFF009D02+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMFF035A23+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMSF044N15+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMSF017C07+ TCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
JMFF028G19+ AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
                      ____________________________________________________________
consensus AATCCAGCATAAAAAGCAGCCATCCTGCACTCACTTGCCCTTATAGATCCAGGTGCCAAG
 
. : . : . : . : . : . :
JMFS138C10+ ACTGAACCC
JMFF045K07+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMFF006D15+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMSF015C16+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMSF039A12+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMFF024B23+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMFF024E12+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMFF009D02+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMFF035A23+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMSF044N15+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMSF017C07+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
JMFF028G19+ ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
                      ____________________________________________________________
consensus ACTGTACCCACAATTATATCCCCAACTTCACTAGGGTTCAAATTAGTTTTCTCAATCAAT
 
. : . : . : . : . : . :
JMFF045K07+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMFF006D15+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMSF015C16+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMSF039A12+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMFF024B23+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMFF024E12+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMFF009D02+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMFF035A23+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMSF044N15+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMSF017C07+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
JMFF028G19+ GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
                      ____________________________________________________________
consensus GCCTTTAGCACAGAGGCAAGTAAATCATCTGGGTAAGTATCTTTGAAGCCACCCCTCTTT
 
. : . : . : . : . : . :
JMFF045K07+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMFF006D15+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMSF015C16+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMSF039A12+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMFF024B23+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMFF024E12+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMFF009D02+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMFF035A23+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMSF044N15+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMSF017C07+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMFF028G19+ GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
JMSF008O20+ AACAGAA
                      ____________________________________________________________
consensus GATTTGCAAAGAGGTGTCCTATATGCAGCAACAATGACTATATCATCTCCATAAACAGAA
 
. : . : . : . : . : . :
JMFF045K07+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMFF006D15+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMSF015C16+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMSF039A12+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMFF024B23+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMFF024E12+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMFF009D02+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMFF035A23+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMSF044N15+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMSF017C07+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMFF028G19+ TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
JMSF008O20+ TTCNTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
                      ____________________________________________________________
consensus TTCCTCTGATATGCAGCACTATCCCCAGCAGCACATACAGATGCAGAAACAGAGGATTCG
 
. : . : . : . : . : . :
JMFF045K07+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMFF006D15+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMSF015C16+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMSF039A12+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMFF024B23+ ATGGAATCGTGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMFF024E12+ ATGGAATCGTGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMFF009D02+ ATGGAATCGTGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMFF035A23+ ATGGAATCGTGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMSF044N15+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMSF017C07+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMFF028G19+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
JMSF008O20+ ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
                      ____________________________________________________________
consensus ATGGAATCGAGGGAAGAGGCAGCGTTAGTTGGTCGTAGGTGCTGAAGCAGAACCCTTTGT
 
. : . : . : . : . : . :
JMFF045K07+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMFF006D15+ CTCTCAATT
JMSF015C16+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMSF039A12+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMFF024B23+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMFF024E12+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMFF009D02+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMFF035A23+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMSF044N15+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMSF017C07+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMFF028G19+ CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
JMSF008O20+ CTCTCAATTGCCTTCTCCATACCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
                      ____________________________________________________________
consensus CTCTCAATTGCCTTCTCCATATCTCTCTCTCTCTCTTTCTCTTTCTCTCTCTCTAACAGA
 
. : . : . : . : . : . :
JMFF045K07+ AGT
JMSF015C16+ AGTGTGT
JMSF039A12+ AGTGTGTATC
JMFF024B23+ AGTGTGTATC
JMFF024E12+ AGTGTGTA
JMFF009D02+ AGTGTGTATC
JMFF035A23+ AGTGTGTA
JMSF044N15+ AGTGTGTATC
JMSF017C07+ AGTGTGT
JMFF028G19+ AGTGTGTATCGAATTCAAACGTGTGCGTGTCTTTATATAAATAGTATGTGGTTAAGC
JMSF008O20+ AGTGTGTATCGAATTCAAACGTGTGCGTGTCTTTATATAAATAGTATGTGGTTAAGCATC
                      ____________________________________________________________
consensus AGTGTGTATCGAATTCAAACGTGTGCGTGTCTTTATATAAATAGTATGTGGTTAAGCATC