Previous Contig 005039:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008O16Sequence219005039 (3)648011475 (3)gb:AF202987_17765466e-82Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.
JMSF018E24Sequence461005039 (3)gb:AF202987_17765467e-32Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.634011475 (3)gb:AF202987_17765465e-82Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.
JMSF028O19Sequence662005039 (3)gb:AF202987_17765465e-62Petroselinum crispum acyl-CoA oxidase (ACO) gene, complete cds.723023359gb:AY735668_16257103e-48Arabidopsis thaliana hypothetical protein AT4G39790 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028O19+ GAAGGCCTTGAACATNGGAACCATGATGAAGCTCAGTCATTGCAAAGCAACCGGTGTA
                      ____________________________________________________________
consensus GAAGGCCTTGAACATNGGAACCATGATGAAGCTCAGTCATTGCAAAGCAACCGGTGTA
 
. : . : . : . : . : . :
JMSF028O19+ TTCCAGGTTGTCTATGCCTTCAAAGTACTTGTCTCTGTGTTTCTTAGTTCCCAAATTGAG
                      ____________________________________________________________
consensus TTCCAGGTTGTCTATGCCTTCAAAGTACTTGTCTCTGTGTTTCTTAGTTCCCAAATTGAG
 
. : . : . : . : . : . :
JMSF028O19+ AACAGAGCCTCCCCAAAGACTGTACTGAACACCCAGCTTGATACCTAAAGAAATATCAAC
                      ____________________________________________________________
consensus AACAGAGCCTCCCCAAAGACTGTACTGAACACCCAGCTTGATACCTAAAGAAATATCAAC
 
. : . : . : . : . : . :
JMSF018E24+ CCGCAATAGCGAAATACTTAACAGGGTCGTCGACCACGTATCTGAA
JMSF028O19+ GCTACCTGCAGCCTCCGCAATAGCGAAATACTTAACAGGGTCGTCGACCACGTAT--GAA
                      ____________________________________________________________
consensus GCTACCTGCAGCCTCCGCAATAGCGAAATACTTAACAGGGTCGTCGACCACGTATCTGAA
 
. : . : . : . : . : . :
JMSF018E24+ GGGCCTTATCCCTGCCTCATGGACCAGACCCCTAAGCTGCCTCATGCACAATTCCCTGTG
JMSF028O19+ GGGCCTTATCCCTGCCTCATGGACCAGGCCCCTAAGCTGCCTCATGCACAATTCCCTGTG
                      ____________________________________________________________
consensus GGGCCTTATCCCTGCCTCATGGACCAGGCCCCTAAGCTGCCTCATGCACAATTCCCTGTG
 
. : . : . : . : . : . :
JMSF018E24+ CTCATCCTTGGAGATCTCGATAGGCGTCTGCAAATCCGGCCTGGATTTGAAGAACTCGTA
JMSF028O19+ CTCATCCTTGGAGATCTCGATAGGCGTCTGCAAATCCGGCCTGGATTTGAAGAACTCGTA
                      ____________________________________________________________
consensus CTCATCCTTGGAGATCTCGATAGGCGTCTGCAAATCCGGCCTGGATTTGAAGAACTCGTA
 
. : . : . : . : . : . :
JMSF018E24+ CACCTTATCTTGGATGTCTCGGTGCCTCCCTTTCATGTACTGCAACAACATATCCGTCCT
JMSF028O19+ CACCTTATCTTGGATGTCTCGGTGCCTCCCTTTCATGTACTGCAACAACATATCCGTCCT
                      ____________________________________________________________
consensus CACCTTATCTTGGATGTCTCGGTGCCTCCCTTTCATGTACTGCAACAACATATCCGTCCT
 
. : . : . : . : . : . :
JMSF018E24+ CACCTTCAACACCTTCGCCTTCCCCTTCCCCTTCCCCGCGCACATTAACATCTCCAGGCC
JMSF028O19+ CACCTTCAACACCTTCGCCTTCCCCTTCCCCTTCCCCGCGCACATTAACATCTCCAGGCC
                      ____________________________________________________________
consensus CACCTTCAACACCTTCGCCTTCCCCTTCCCCTTCCCCGCGCACATTAACATCTCCAGGCC
 
. : . : . : . : . : . :
JMSF018E24+ GCGATCCGGAAAGTCCGGGAAAAGCGCCGGGTTGAGGTGCAATGACAGCCGCCGCATGCG
JMSF028O19+ GCGATCCGGAAAGTCCGGGAAAAGCGCCGGGTTGAGGTGCAATGACAGCCGCCGCATGCG
JMSF008O16+ AAGCGCCGGGTTGAGGTGCAATGACAGCCGCCGCATGCG
                      ____________________________________________________________
consensus GCGATCCGGAAAGTCCGGGAAAAGCGCCGGGTTGAGGTGCAATGACAGCCGCCGCATGCG
 
. : . : . : . : . : . :
JMSF018E24+ GCGGTGGATGAGCTGCATGTCGTCGCGATTTTCATCTTCCACCGCCGTGTCATCGGAACT
JMSF028O19+ GCGGTGGATGAGCTGCATGTCGTCGCGATTTTCATCTTCCACCGCCGTGTCATCGGAACT
JMSF008O16+ GCGGTGGATGAGCTGCATGTCGTCGCGATTTTCATCTTCCACCGCCGTGTCATCGGAACT
                      ____________________________________________________________
consensus GCGGTGGATGAGCTGCATGTCGTCGCGATTTTCATCTTCCACCGCCGTGTCATCGGAACT
 
. : . : . : . : . : . :
JMSF018E24+ TCGTGACGTCACCTCCGGGAGGTCCATTGCCTTGCTCTAATTGTCAAATCAAAT
JMSF028O19+ TCGTGACGTCACCTCCGGGAGGTCCATTGCCTTGCTCTAATTGTCAAATCAAATGTATTG
JMSF008O16+ TCGTGACGTCACCTCCGGGAGGTCCATTGCCTTGCTCTAATTGTCAAATCAAATGTATTG
                      ____________________________________________________________
consensus TCGTGACGTCACCTCCGGGAGGTCCATTGCCTTGCTCTAATTGTCAAATCAAATGTATTG
 
. : . : . : . : . : . :
JMSF028O19+ TATAT
JMSF008O16+ TATATGAAACGAGAATCGTATTCGTAGTCGTATATATATACATACGCGTCGGTATAGGTC
                      ____________________________________________________________
consensus TATATGAAACGAGAATCGTATTCGTAGTCGTATATATATACATACGCGTCGGTATAGGTC