Previous Contig 005037:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007A24Sequence550005037 (28)sp|P09043|G3PA_TOBAC2e-61Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 667005037 (28)sp|P19866|G3PA_SPIOL5e-59Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)
JMFF016H04Sequence533005037 (28)sp|P09043|G3PA_TOBAC8e-58Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 703005037 (28)sp|P19866|G3PA_SPIOL5e-64Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)
JMFF023H10Sequence502005037 (28)sp|P09043|G3PA_TOBAC2e-53Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 709005037 (28)sp|P19866|G3PA_SPIOL2e-65Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)
JMFS002H02Sequence415005037 (28)sp|P09043|G3PA_TOBAC3e-40Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)
JMFS079F11Sequence617005037 (28)sp|P09043|G3PA_TOBAC3e-86Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)
JMSF008O09Sequence213005037 (28)717005037 (28)gb:ATHGAPAA_15531908e-80Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase A subunit (GapA) m
JMSF013J06Sequence557005037 (28)sp|P09043|G3PA_TOBAC1e-62Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 757005037 (28)gb:ATHGAPAA_15531905e-78Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase A subunit (GapA) m
JMSF015E08Sequence265005037 (28)sp|P09043|G3PA_TOBAC1e-06Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 777005037 (28)gb:ATHGAPAA_15531901e-78Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase A subunit (GapA) m
JMSF019D02Sequence380005037 (28)sp|P09043|G3PA_TOBAC6e-30Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 774005037 (28)sp|P25856|G3PA_ARATHe-101Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)
JMSF020H01Sequence589005037 (28)sp|P09043|G3PA_TOBAC2e-68Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 757005037 (28)gb:OSJN00003_16930953e-74Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16, complete seque
JMSF029F03Sequence561005037 (28)sp|P09043|G3PA_TOBAC3e-63Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 717008551 (67)gb:AY066012_1566585e-106Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF038D18Sequence696005037 (28)sp|P09043|G3PA_TOBAC4e-89Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 897005037 (28)sp|P25856|G3PA_ARATHe-101Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)
JMSF039G21Sequence701005037 (28)sp|P09043|G3PA_TOBAC4e-90Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 839005037 (28)gb:ATHGAPAA_15531909e-90Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase A subunit (GapA) m
JMSF040F03Sequence651005037 (28)sp|P09043|G3PA_TOBAC1e-81Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 873005037 (28)gb:OSJN00003_1693095e-109Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16, complete seque
JMSF045C13Sequence741005037 (28)sp|P09043|G3PA_TOBAC4e-98Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 740000308 (34)gb:AY087366_15723988e-87Arabidopsis thaliana clone 34612 mRNA, complete sequence.>gb:BT004124_1637224 Ar
JMSF049I02Sequence656005037 (28)sp|P09043|G3PA_TOBAC1e-81Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 712005037 (28)sp|P19866|G3PA_SPIOL9e-61Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016H04- AGCTCCAATAATATAATGGAGATGAAAAATTGTTTTGAGG
rJMFF007A24- AAATTGTTTTGAGG
rJMFF023H10- TATTTGAATTAAGCTCCAATAATATAATGGAGATGAAAAATTGTTTTGAGG
rJMSF020H01- AATGGAGATGAAAAATTGTTTTGAGG
rJMSF049I02- ATAATATAATGGAGATGAAAAATTGTTTTGAGG
rJMSF015E08- AGCTCCAATAATATAATGGAGATGAAAAATTGTTTTGAGG
rJMSF039G21- AGCTCCAATAATATAATGGAGATGAAAAATTGTTTTGAGG
rJMSF013J06- ATGGAGATGAAAAATTGTTTTGAGG
rJMSF038D18- ATAATATAATGGAGATGAAAAATTGTTTTGAGG
                      ____________________________________________________________
consensus TATTTGAATTAAGCTCCAATAATATAATGGAGATGAAAAATTGTTTTGAGG
 
. : . : . : . : . : . :
rJMFF016H04- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMFF007A24- -ATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMFF023H10- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF020H01- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF049I02- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF015E08- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF039G21- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF013J06- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF008O09- TACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF038D18- AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
rJMSF040F03- CAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
                      ____________________________________________________________
consensus AATTAAATTCTCATCACAGTACACTTTGGAGGAAGAAGGAAATTAAAGAAACAATCTACA
 
. : . : . : . : . : . :
rJMFF016H04- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMFF007A24- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMFF023H10- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF020H01- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF049I02- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF015E08- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF039G21- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF013J06- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF008O09- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF038D18- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF019D02- AAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
rJMSF040F03- TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
                      ____________________________________________________________
consensus TACATAGTACAAAAGTTATATATATATGCTAATACTTTGAGAGGTTTAGATGAGAGGCCG
 
. : . : . : . : . : . :
rJMFF016H04- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMFF007A24- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMFF023H10- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF020H01- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF049I02- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF015E08- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF039G21- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF013J06- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF008O09- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF038D18- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF019D02- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
rJMSF040F03- GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
                      ____________________________________________________________
consensus GCATTTATTTCCATTGATTTGCAACAATGTCAGCAAGATCCACAACCCTCTGTGAGTAAC
 
. : . : . : . : . : . :
rJMFF016H04- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMFF007A24- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMFF023H10- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF020H01- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF049I02- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF015E08- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF039G21- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF013J06- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF008O09- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF038D18- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF019D02- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
rJMSF040F03- CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
                      ____________________________________________________________
consensus CCCATTCATTGTCGTACCAGGCAATAACCTTAACCATGTCGTCTCCCATGACCATGGTGA
 
. : . : . : . : . : . :
rJMFF016H04- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMFF007A24- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMFF023H10- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF020H01- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF049I02- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF015E08- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF039G21- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF013J06- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF008O09- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF038D18- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF019D02- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
rJMSF040F03- GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
                      ____________________________________________________________
consensus GCGAGGAGTCCACCGTGGACGACACATCGCTGCATCTGAAGTCGACCGACACAAGGGGCT
 
. : . : . : . : . : . :
rJMFF016H04- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMFF007A24- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMFF023H10- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF020H01- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF049I02- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF015E08- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF039G21- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF013J06- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF008O09- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF038D18- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF019D02- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
rJMSF040F03- CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
                      ____________________________________________________________
consensus CGTCGCAGACGGAGAGGATGCCGTCGAGCTCGTTGGCGGCGGATTCCCTGAACGCGGCGT
 
. : . : . : . : . : . :
rJMFF016H04- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMFF007A24- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMFF023H10- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF020H01- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF049I02- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF015E08- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF039G21- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF013J06- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF008O09- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF038D18- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF019D02- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
rJMSF040F03- TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
                      ____________________________________________________________
consensus TGACTTCCTCGGCGAAGGTCTTCTTGGAGACCTGAACGACGAGGTCGACGACGGAGACGT
 
. : . : . : . : . : . :
rJMFF016H04- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMFF007A24- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMFF023H10- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF020H01- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF049I02- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF015E08- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF039G21- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF013J06- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF008O09- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF038D18- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF019D02- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
rJMSF040F03- TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
                      ____________________________________________________________
consensus TGGGGGTGGGGACTCGGAGGGCGATGCCGTTGAGCTTGCCCTTGAGGCTGGGGAGGACAA
 
. : . : . : . : . : . :
rJMFF016H04- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMFF007A24- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMFF023H10- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF020H01- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF049I02- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF015E08- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF039G21- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF013J06- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF008O09- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF038D18- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF019D02- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
rJMSF040F03- GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
                      ____________________________________________________________
consensus GCGCGACGGCCTTGGCGGCGCCGGTTGAGGTTGGGACAATGTTGAGCGCGGCGGCTCTTG
 
. : . : . : . : . : . :
rJMFF016H04- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMFF007A24- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMFF023H10- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF020H01- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF049I02- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF015E08- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF039G21- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF013J06- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF008O09- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF038D18- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF019D02- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
rJMSF040F03- CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
                      ____________________________________________________________
consensus CACGTCGGAGATCCCTGTGGCTGGCGTCCAGCAGCCTCTGGTCGCCGGTGTAGGAGTGAG
 
. : . : . : . : . : . :
rJMFF016H04- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACG
rJMFF007A24- TAGTAGTCATGGGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACG
rJMFF023H10- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGG
rJMSF020H01- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF049I02- TAGTAGTCAT-GGTGCCCTTGATGATGCCNAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF015E08- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF039G21- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF013J06- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF008O09- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF038D18- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF019D02- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
rJMSF040F03- TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
JMSF045C13+ GGTCGAGGACCTTGACGAAAGGA
                      ____________________________________________________________
consensus TAGTAGTCAT-GGTGCCCTTGATGATGCCAAATTTCTGGTCGAGGACCTTGACGAAAGGA
 
. : . : . : . : . : . :
rJMSF020H01- GCAAGGCAGTTGGTGGTGCAAGANGCGTTTGCTGATGATGGGCTCATCGGGGCTGTAAGC
rJMSF049I02- GCAAGGCAGTTGGT
rJMSF015E08- GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
rJMSF039G21- GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
rJMSF013J06- GCAAGGCAGTTGGTGGTGCAAGANGCG-TTGCTGATGATGGGCTCATCGGGCCTGTAAGC
rJMSF008O09- GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
rJMSF038D18- GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
rJMSF019D02- GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
rJMSF040F03- GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
JMFS079F11+ ATGATGGGCTCATCGGGGCTGTAAGC
JMSF038D18+ AGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
JMSF039G21+ GCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
JMSF045C13+ GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
                      ____________________________________________________________
consensus GCAAGGCAGTTGGTGGTGCAAGAGGCG-TTGCTGATGATGGGCTCATCGGGGCTGTAAGC
 
. : . : . : . : . : . :
rJMSF020H01- GTCGGCGTTGAC
rJMSF015E08- GTCGGCGTTGAC
rJMSF039G21- GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAN
rJMSF013J06- GTCGGCGTTGACGC
rJMSF008O09- GTCGGCGTTGACGCCCAC
rJMSF038D18- GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAN
rJMSF019D02- GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
rJMSF040F03- GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
JMSF040F03+ CGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
JMFS079F11+ GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
JMSF038D18+ GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
JMSF039G21+ GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
JMSF045C13+ GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
JMSF049I02+ GGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
                      ____________________________________________________________
consensus GTCGGCGTTGACGCCCACAACGTAGGTGGGGATGTCGCCCTTTCCCGGTGCTGTGATCAG
 
. : . : . : . : . : . :
rJMSF039G21- AACCTTCTTCGC
rJMSF038D18- AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
rJMSF019D02- AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
rJMSF040F03- AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMSF040F03+ AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMFS079F11+ AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMSF038D18+ AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMSF039G21+ AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMSF045C13+ AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMSF049I02+ AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMSF029F03+ CTTCTCTGTCCACGAAAACACC
JMSF020H01+ GCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
JMFF007A24+ TCCACGAAAACACC
JMSF013J06+ TCTGTCCACGAAAACACC
                      ____________________________________________________________
consensus AACCTTCTTCGCTCCGGCCTCGATATGTTTTCCGGCGCCTTCTCTGTCCACGAAAACACC
 
. : . : . : . : . : . :
rJMSF038D18- GGTTCCCCTCAATAACCAAATCGATT
rJMSF019D02- GGTT-CCC
rJMSF040F03- GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAG
JMSF040F03+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMFS079F11+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMSF038D18+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMSF039G21+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMSF045C13+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMSF049I02+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMSF029F03+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMSF020H01+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMFF023H10+ CCCCCCAAGGGAGGTTGAGGGGGTTGC
JMFF007A24+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMFF016H04+ CCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
JMSF013J06+ GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
                      ____________________________________________________________
consensus GGTT-CCCTCAATAACCAAATCGATTCCCAATTCCCCCCAAGGGAGGTTGAGGGGGTTGC
 
. : . : . : . : . : . :
JMSF040F03+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMFS079F11+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMSF038D18+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMSF039G21+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMSF045C13+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMSF049I02+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMSF029F03+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMSF020H01+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMFF023H10+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMFS002H02+ TCGCCGACGGGCT
JMFF007A24+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMFF016H04+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
JMSF013J06+ GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
                      ____________________________________________________________
consensus GGCTGGATACGACTTTGATGACCTTGCCGTCGACGGAGATGCCATCGTCGCCGACGGGCT
 
. : . : . : . : . : . :
JMSF040F03+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMFS079F11+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF038D18+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF039G21+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF045C13+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF049I02+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF029F03+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF020H01+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMFF023H10+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMFS002H02+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMFF007A24+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF019D02+ GAGAAGGTGAGAGGCCTGCT
JMFF016H04+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
JMSF013J06+ TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
                      ____________________________________________________________
consensus TGACATCGGCGTCGAAGATGCCGAGGGTGGAGTCGTATTTGAGAAGGTGAGAGGCCTGCT
 
. : . : . : . : . : . :
JMSF040F03+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMFS079F11+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF038D18+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF039G21+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF045C13+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF049I02+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF029F03+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF020H01+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMFF023H10+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMFS002H02+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMFF007A24+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF019D02+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMFF016H04+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
JMSF013J06+ TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
                      ____________________________________________________________
consensus TCACACCTCCGGTGTCGTTGATGGCAATGACGTCAAGGGGAGAATCCTTCCTTCCATGCC
 
. : . : . : . : . : . :
JMSF040F03+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMFS079F11+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF038D18+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF039G21+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF045C13+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF049I02+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF029F03+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF020H01+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMFF023H10+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMFS002H02+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMFF007A24+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF019D02+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF015E08+ CCGAATCCATTAATGGCCACCTTCAGCTTCG
JMFF016H04+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
JMSF013J06+ AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
                      ____________________________________________________________
consensus AACACCTCAAGAAGTTCCTTCCAATTCTTCCGAATCCATTAATGGCCACCTTCAGCTTCG
 
. : . : . : . : . : . :
JMSF040F03+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMFS079F11+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF038D18+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF039G21+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF045C13+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF049I02+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF029F03+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF020H01+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMFF023H10+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMFS002H02+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMFF007A24+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF019D02+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF015E08+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMFF016H04+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF013J06+ CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
JMSF008O09+ CTCCGACAACAGAGGTCTGGAAGGAAACGACGG
                      ____________________________________________________________
consensus CCTCCACTACTGCCCTCCTCTGCTTCCCTCCGACAACAGAGGTCTGGAAGGAAACGACGG
 
. : . : . : . : . : . :
JMSF040F03+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMFS079F11+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF038D18+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF039G21+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF045C13+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF049I02+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF029F03+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF020H01+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMFF023H10+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMFS002H02+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMFF007A24+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF019D02+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF015E08+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMFF016H04+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF013J06+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
JMSF008O09+ AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
                      ____________________________________________________________
consensus AGTGCAAGTCGTCATAGGATCTCCGCGCGAACGGAAGCGACGAAGACGAGCTGCGAAGTC
 
. : . : . : . : . : . :
JMSF040F03+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMFS079F11+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGT
JMSF038D18+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF039G21+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF045C13+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF049I02+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF029F03+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF020H01+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMFF023H10+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMFS002H02+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMFF007A24+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF019D02+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF015E08+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMFF016H04+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF013J06+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
JMSF008O09+ CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
                      ____________________________________________________________
consensus CGGAGAACTCCGACGACAATCCCTTGTTGCTCACCTGGTGGAGAGTGGAGTTGGCTACGG
 
. : . : . : . : . : . :
JMSF040F03+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGATGAGGAGAGTTA
JMSF038D18+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAA
JMSF039G21+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAAC
JMSF045C13+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTG
JMSF049I02+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTGCC
JMSF029F03+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTG
JMSF020H01+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTGCC
JMFF023H10+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAG
JMFS002H02+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGA
JMFF007A24+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTAAACT
JMSF019D02+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAAC
JMSF015E08+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTT
JMFF016H04+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTGC
JMSF013J06+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTGCC
JMSF008O09+ AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTGCC
                      ____________________________________________________________
consensus AAAGAGCAGCCGAAGCCATGGCGGGGTTTACAGGAGGAGCGAGGAGGAGAGTTAACTGCC