Previous Contig 005036:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007F18Sequence584005036 (7)gb:AC151815_17451661e-84Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.729005036 (7)gb:AC151815_17451662e-76Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.
JMFF025C15Sequence554005036 (7)gb:AC151815_17451669e-85Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.271005036 (7)
JMFF035O11Sequence573005036 (7)gb:AC151815_17451662e-83Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.
JMSF008N23Sequence344005036 (7)715005036 (7)gb:AC151815_17451662e-87Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025C15- C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
rJMFF025C15- AGACTGTTTAAGCAACATGATTCTAACTTTCTAAGCTGGCAAAATCCTTAAAATGAAGTT
                      ____________________________________________________________
consensus AGACTGTTTAAGCAACATGATTCTAACTTTCTAAGCTGGCAAAATCCTTAAAATGAAGTT
 
. : . : . : . : . : . :
rJMFF025C15- CTCCAACATCATTAATTGTTTTCTGTTTCCAAAGTGACAAGCCACACCTCATTCTTCACT
                      ____________________________________________________________
consensus CTCCAACATCATTAATTGTTTTCTGTTTCCAAAGTGACAAGCCACACCTCATTCTTCACT
 
. : . : . : . : . : . :
rJMFF025C15- TTTTGATATTTTTATTTTGGATGTCAGACAAGGTGTCAAGGACCTCATTCTTCATCCTCT
rJMFF007F18- CTCATTCTTCATCCTCT
rJMSF008N23- CTCATTCTTCATCCTCT
                      ____________________________________________________________
consensus TTTTGATATTTTTATTTTGGATGTCAGACAAGGTGTCAAGGACCTCATTCTTCATCCTCT
 
. : . : . : . : . : . :
rJMFF025C15- TCATCACCATCACCCCCAGAAGCCTTCTTTGCGGCAGCCTTCTGGNTCTTTCTCTTCACT
rJMFF007F18- TCATCACCATCACCCCCAGAAGCCTTCTTTGCGGCAGCCTTCTGGTTCTTTCTCTTCACT
rJMSF008N23- TCATCACCATCACCCCCAGAAGCCTTCTTTGCGGCAGCCTTCTGGTTCTTTCTCTTCACT
                      ____________________________________________________________
consensus TCATCACCATCACCCCCAGAAGCCTTCTTTGCGGCAGCCTTCTGGTTCTTTCTCTTCACT
 
. : . : . : . : . : . :
rJMFF025C15- CTGCCAGGGCGTCCACCACCGAAAGGACTA
rJMFF007F18- CTGCCAGGGCGTCCACCACCGAAAGGACTAGAGAGAGAGAAATCAATGTGTTTCTGGGAG
rJMSF008N23- CTGCCAGGGCGTCCACCACCGAAAGGACTAGAGAGAGAGAAATCAATGTGTTTCTGGGAG
JMFF007F18+ AAAGGACTAGAGAGAGAGAAATCAATGTGTTTCTGGGAG
JMFF035O11+ TAGAGAGAGAGAAATCAATGTGTTTCTGGGAG
JMFF025C15+ AGGACTAGAGAGAGAGAAATCAATGTGTTTCTGGGAG
                      ____________________________________________________________
consensus CTGCCAGGGCGTCCACCACCGAAAGGACTAGAGAGAGAGAAATCAATGTGTTTCTGGGAG
 
. : . : . : . : . : . :
rJMFF007F18- TCCATTCTAACCAAAAATGAGGGAACATTCACCACCTGCCTTCCAACCCTGATATGCTTT
rJMSF008N23- TCCATTCTAACCAAAAATGAGGGAACATTCACCACCTGCCTTCCAACCCTGATATGCTTT
JMFF007F18+ TCCATTCTAACCAAAAATGAGGGAACATTCACCACCTGCCTTCCAACCCTGATATGCTTT
JMFF035O11+ TCCATTCTAACCAAAAATGAGGGAACATTCACCACCTGCCTTCCAACCCTGATATGCTTT
JMFF025C15+ TCCATTCTAACCAAAAATGAGGGAACATTCACCACCTGCCTTCCAACCCTGATATGCTTT
                      ____________________________________________________________
consensus TCCATTCTAACCAAAAATGAGGGAACATTCACCACCTGCCTTCCAACCCTGATATGCTTT
 
. : . : . : . : . : . :
rJMFF007F18- TGCCTAATTANAACTCTGGCATGATGGATTGATTTTGCCATGCCAGCCTTGAAAACGAGA
rJMSF008N23- TGCCTAATTAGAACTCTGGCATGATGGATTGATTTTGCCATTCCAGCCTTGAAAACGAGA
JMFF007F18+ TGCCTAATTAGAACTCTGGCATGATGGATTGATTTTGCCATGCCAGCCTTGCAANCGAGA
JMFF035O11+ TGCCTAATTAGAACTCTGGCATGATGGATTGATTTTGCCATGCCAGCCTTGAAAACGAGA
JMFF025C15+ TGCCTAATTAGAACTCTGGCATGATGGATTGATTTTGCCATGCCAGCCTTGAAAACGAGA
                      ____________________________________________________________
consensus TGCCTAATTAGAACTCTGGCATGATGGATTGATTTTGCCATGCCAGCCTTGAAAACGAGA
 
. : . : . : . : . : . :
rJMFF007F18- GTTTGGAGACGGCGTTCAAGGAAGTTCTCCACAGTGAGGGCAAGGACATAATCAAGCTTG
rJMSF008N23- GTTTGGAGACGGCGTTCAAGGAAGTTCTCCACAGTGAGGGCAAGGACATAATCAAGCTTG
JMFF007F18+ GTTTGGAGACGGCGTTCAAGGAAGTTCTCCACAGTGAGGGCAAGGACATAATCAAGCTTG
JMFF035O11+ GTTTGGAGACGGCGTTCAAGGAAGTTCTCCACAGTGAGGGCAAGGACATAATCAAGCTTG
JMFF025C15+ GTTTGGAGACGGCGTTCAAGGAAGTTCTCCACAGTGAGGGCAAGGACATAATCAAGCTTG
                      ____________________________________________________________
consensus GTTTGGAGACGGCGTTCAAGGAAGTTCTCCACAGTGAGGGCAAGGACATAATCAAGCTTG
 
. : . : . : . : . : . :
rJMFF007F18- TTCTGGCTCTCATCCAACAAACCATACCTGTTCATTCTCCTCAGGAGGGCATCGCCCTCA
rJMSF008N23- TTCTGGCTCTCATCCAACAAACCATACCTGTTCATTCTCCTCAGGAGGGCATCGCCCTCA
JMFF007F18+ TTCTGGCTCTCATCCAACAAACCATACCTGTTCATTCTCCTCAGGAGGGCATCGCCCTCA
JMFF035O11+ TTCTGGCTCTCATCCAACAAACCATACCTGTTCATTCTCCTCAGGAGGGCATCGCCCTCA
JMFF025C15+ TTCTGGCTCTCATCCAACAAACCATACCTGTTCATTCTCCTCAGGAGGGCATCGCCCTCA
                      ____________________________________________________________
consensus TTCTGGCTCTCATCCAACAAACCATACCTGTTCATTCTCCTCAGGAGGGCATCGCCCTCA
 
. : . : . : . : . : . :
rJMFF007F18- AAAATACGGCGTGGGTCCTTCTCATCAAGAGTAAGAAGCATTCTTGCATTATTCCTGATT
rJMSF008N23- AAAATACGGCGTGGGTCCTTCTCATCAAGAGTAAGAAGCATTCTTGCATTATTCCTGATT
JMFF007F18+ AAAATACGGCGTGGGTCCTTCTCATCAAGAGTAAGAAGCATTCTTGCATTATTCCTGATT
JMFF035O11+ AAAATACGGCGTGGGTCCTTCTCATCAAGAGTAAGAAGCATTCTTGCATTATTCCTGATT
JMFF025C15+ AAAATACGGCGTGGGTCCTTCTCATCAAGAGTAAGAAGCATTCTTGCATTATTCCTGATT
                      ____________________________________________________________
consensus AAAATACGGCGTGGGTCCTTCTCATCAAGAGTAAGAAGCATTCTTGCATTATTCCTGATT
 
. : . : . : . : . : . :
rJMFF007F18- CGGCTCAAAGCATACTGTACTCTCCAAAGCTCCCTCTTGCACCTAAGACCATACTCACCC
rJMSF008N23- CGGCTCAAAGCATACTGTACTCTCCAAAGCTCCCTCTTGCACCTAAGACCATACTCACCC
JMFF007F18+ CGGCTCAAAGCATACTGTACTCTCCAAAGCTCCCTCTTGCACCTAAGACCATACTCACCC
JMFF035O11+ CGGCTCAAAGCATACTGTACTCTCCAAAGCTCCCTCTTGCACCTAAGACCATACTCACCC
JMFF025C15+ CGGCTCAAAGCATACTGTACTCTCCAAAGCTCCCTCTTGCACCTAAGACCATACTCACCC
                      ____________________________________________________________
consensus CGGCTCAAAGCATACTGTACTCTCCAAAGCTCCCTCTTGCACCTAAGACCATACTCACCC
 
. : . : . : . : . : . :
rJMFF007F18- AAAAAGTTTCAACTCCGCATCCAAACGCTCTTTCTCATATGGAC
rJMSF008N23- -AAAAGTTTCAACTCCGCATCCAAACGCTCTTTCTCATATGGACGTCGAGGCTTCTTGAA
JMFF007F18+ -AAAAGTTTCAACTCCGCATCCAAACGCTCTTTCTCATATGGACGTCGAGGCTTCTTGAA
JMFF035O11+ -AAAAGTTTCAACTCCGCATCCAAACGCTCTTTCTCATATGGACGTCGAGGCTTCTTGAA
JMFF025C15+ -AAAAGTTTCAACTCCGCATCCAAACGCTCTTTCTCATATGGACGTCGAGGCTTCTTGAA
                      ____________________________________________________________
consensus -AAAAGTTTCAACTCCGCATCCAAACGCTCTTTCTCATATGGACGTCGAGGCTTCTTGAA
 
. : . : . : . : . : . :
rJMSF008N23- TGTCTTTCCAT
JMFF007F18+ TGTCTTTCCATAATTGCGGTAAAAGTTGACGTGAACCATGCTG
JMFF035O11+ TGTCTTTCCATAATTGCGGTAAAAGTTGACGTGAACCATGCTG
JMFF025C15+ TGTCTTTCCATAATTGCGGTAAAAGTTGACGTGAACCATGCTGCTAAGCCGCCGCACACG
JMSF008N23+ AATTGCGGTAAAAGTTGACGTGAACCATGCTGCTAAGCCGCCGCACACG
                      ____________________________________________________________
consensus TGTCTTTCCATAATTGCGGTAAAAGTTGACGTGAACCATGCTGCTAAGCCGCCGCACACG
 
. : . : . : . : . : . :
JMFF025C15+ GCGGTGTGATCCTCAGTCCGGTGCTCAAGGTGCAATCT
JMSF008N23+ GCGGTGTGATCCTCAGTCCGGTGCTCAAGGTGCAATCTGGAGTGGAGACTAGGGTTTCCC
                      ____________________________________________________________
consensus GCGGTGTGATCCTCAGTCCGGTGCTCAAGGTGCAATCTGGAGTGGAGACTAGGGTTTCCC