Previous Contig 005034:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022D22Sequence520005034 (20)sp|P30361|UCRA_TOBAC2e-51Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99760005034 (20)sp|P30361|UCRA_TOBAC5e-74Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMFF027F24Sequence528005034 (20)gb:AY300039_15967393e-54Solanum tuberosum putative Rieske Fe-S protein precursor (FeS) mRNA, complete cd682005034 (20)sp|P30361|UCRA_TOBAC8e-74Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMFF032N22Sequence533005034 (20)gb:AY300039_15967394e-53Solanum tuberosum putative Rieske Fe-S protein precursor (FeS) mRNA, complete cd209005034 (20)
JMFN006E11Sequence640005034 (20)sp|P30361|UCRA_TOBAC2e-71Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMFN031K18Sequence619005034 (20)sp|Q02585|UCRB_TOBAC6e-76Cytochrome B6-F complex iron-sulfur subunit 2, chloroplast precursor (EC 1.10.99
JMFN032L22Sequence634005034 (20)sp|P30361|UCRA_TOBAC1e-79Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMSF003B20Sequence257005034 (20)sp|Q02585|UCRB_TOBAC5e-34Cytochrome B6-F complex iron-sulfur subunit 2, chloroplast precursor (EC 1.10.99770010209 (10)gb:BT002324_16359275e-75Arabidopsis thaliana clone C104965 unknown protein (At4g39870) mRNA, complete cd
JMSF008N18Sequence351005034 (20)gb:AY300039_15967391e-13Solanum tuberosum putative Rieske Fe-S protein precursor (FeS) mRNA, complete cd763005034 (20)sp|P30361|UCRA_TOBAC6e-82Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMSF024F17Sequence696005034 (20)sp|P30361|UCRA_TOBAC5e-85Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99769005034 (20)sp|P30361|UCRA_TOBAC4e-81Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMSF040H13Sequence647005034 (20)sp|P30361|UCRA_TOBAC1e-75Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99868005034 (20)sp|P30361|UCRA_TOBAC2e-86Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMSF041H13Sequence741005034 (20)sp|P30361|UCRA_TOBAC7e-91Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99669005034 (20)sp|P30361|UCRA_TOBAC2e-71Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99
JMSF045M16Sequence695005034 (20)sp|P30361|UCRA_TOBAC5e-85Cytochrome B6-F complex iron-sulfur subunit 1, chloroplast precursor (EC 1.10.99520005034 (20)gb:AF093631_17676802e-33Oryza sativa Rieske Fe-S precursor protein (RISP) mRNA, complete cds.>gb:AP00512

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045M16- ATATGCNTGCACTGTTCATNGAACAGGC
                      ____________________________________________________________
consensus ATATGCNTGCACTGTTCATNGAACAGGC
 
. : . : . : . : . : . :
rJMFF032N22- TTTG
rJMSF045M16- AAAAACAGAAAGCNAAAGCGGGCCAAGCAAGAGAACAGAATGAAATTTCTATGACATTTG
rJMFF027F24- TTTG
rJMFF022D22- TTTG
                      ____________________________________________________________
consensus AAAAACAGAAAGCNAAAGCGGGCCAAGCAAGAGAACAGAATGAAATTTCTATGACATTTG
 
. : . : . : . : . : . :
rJMFF032N22- ATTGATGATATGATGTTCCAGGC-TACATCCATCACTCAG-TGATATGATGATCAANCCA
rJMSF045M16- NTTGATGATATGATGTTCCAGGCGTACNTCCATCNCTCNN-TGAGATGATGATNAAACCA
rJMFF027F24- ATTGATGATATGATGTTCCAGGC-TACATCCATCACTCAG-TGATATGATGATCAAACCA
JMFN006E11+ AGGC-TACATCCATCACTCAG-TGATATGATGATCAAACCA
rJMFF022D22- ATTGATGATATGATGTTCCAGGC-TACATCCATCACTCAG-TGATATGATGATCAAACCA
rJMSF024F17- TCCATCACTCAGTTGATATGATGATCAAACCA
rJMSF008N18- TCCATCACTCAG-TGATATGATGATCAAACCA
rJMSF041H13- CAGGC-TACATCCATCACTCAG-TGATATGATGATCAAACCA
rJMSF040H13- TGATGTTCCAGGC-TACATCCATCACTCAG-TGATATGATGATCAAACCA
                      ____________________________________________________________
consensus ATTGATGATATGATGTTCCAGGC-TACATCCATCACTCAG-TGATATGATGATCAAACCA
 
. : . : . : . : . : . :
rJMFF032N22- TTANGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
rJMSF045M16- TTAAGTGGGGTGTTCCTGCANTCCANNANCTTAACTATAC-TTTTTTTGTTTCTTGATGA
rJMFF027F24- TTAAGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
JMFN006E11+ TTAAGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
rJMFF022D22- TTAAGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
rJMSF024F17- TTAAGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
rJMSF008N18- TTAAGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
rJMSF041H13- TTAAGTGGGGTGTTCCTGCAATCCAATANCTTANCTATACATTTTTTTGTTTCTTGATGA
rJMSF040H13- TTAAGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
                      ____________________________________________________________
consensus TTAAGTGGGGTGTTCCTGCAATCCAATAACTTAACTATAC-TTTTTTTGTTTCTTGATGA
 
. : . : . : . : . : . :
rJMFF032N22- TCAATTTTCNATACTCATATACTACAAATANTANAAGGAGCAACTTGCAGGAGCTCGGTT
rJMSF045M16- TCAATTTNCGAGACTCATATACTACNAATAGNACANGGAGCAACTTGCAGGAGCTCGGTT
rJMFF027F24- TCAATTTTCGATACTCATATACTACAAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
JMFN006E11+ TCAATTTTCGATACTCATATACTA-AAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
rJMFF022D22- TCAATTTTCGATACTCATATACTACAAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
rJMSF024F17- TCAATTTTCGATACTCATATACTACAAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
rJMSF008N18- TCAATTTTCGATACTCATATACTACAAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
rJMSF041H13- TCAATTTTCGATACTCATATACTACAAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
rJMSF040H13- TCAATTTTCGATACTCATATACTACAAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
                      ____________________________________________________________
consensus TCAATTTTCGATACTCATATACTACAAATAGTACAAGGAGCAACTTGCAGGAGCTCGGTT
 
. : . : . : . : . : . :
rJMFF032N22- TCCTTCAAGCNCNANGTGAAATACC
rJMSF045M16- TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCNATGCCC
rJMFF027F24- TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
JMFN006E11+ TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
rJMFF022D22- TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
rJMSF024F17- TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
rJMSF008N18- TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
rJMSF041H13- TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
rJMSF040H13- TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
JMSF041H13+ CATTCGAAAAAGATGTCTATGCCC
                      ____________________________________________________________
consensus TCCTTCAAGCGCGAGGTGAAATACCCGAGGGTAATTCATTCGAAAAAGATGTCTATGCCC
 
. : . : . : . : . : . :
rJMSF045M16- ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
rJMFF027F24- ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
JMFN006E11+ ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
rJMFF022D22- ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
rJMSF024F17- ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
rJMSF008N18- ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
rJMSF041H13- ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
rJMSF040H13- ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
JMFN032L22+ CCCATGGAACGAACACTACCTTAT
JMFN031K18+ T
JMSF024F17+ TGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
JMSF045M16+ GAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
JMSF041H13+ ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
                      ____________________________________________________________
consensus ACCATGGGTTCTCGCCAGTTCTGAAATCAGTCTCGACCCATGGAACGAACACTACCTTAT
 
. : . : . : . : . : . :
rJMSF045M16- CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
rJMFF027F24- CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
JMFN006E11+ CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
rJMFF022D22- CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
rJMSF024F17- CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
rJMSF008N18- CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
rJMSF041H13- CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
rJMSF040H13- CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
JMFN032L22+ CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
JMFN031K18+ CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
JMSF024F17+ CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
JMSF045M16+ CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
JMSF041H13+ CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
JMSF040H13+ GTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
                      ____________________________________________________________
consensus CATCATCAATGTCGGCATGAGCCAATGCCAAGGACAAAGGAGCTGGTCCTCGAACGACTC
 
. : . : . : . : . : . :
rJMSF045M16- TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
rJMFF027F24- TTCCTTGGTTGTTGTACTGTGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
JMFN006E11+ TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
rJMFF022D22- TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
rJMSF024F17- TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
rJMSF008N18- TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
rJMSF041H13- TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
rJMSF040H13- TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
JMFN032L22+ TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
JMFN031K18+ TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
JMFF032N22+ GT
JMFF027F24+ GGCTGCGT
JMSF024F17+ TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
JMSF045M16+ TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
JMFF022D22+ GGCTGCGT
JMSF041H13+ TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
JMSF040H13+ TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
                      ____________________________________________________________
consensus TTCCTTGGTTGTTGTACTGGGATCCATGGCAAGGACAGATGAATTTGTTCTCGGCTGCGT
 
. : . : . : . : . : . :
rJMSF045M16- TCCATGGCACCACG
rJMFF027F24- TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMFN006E11+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
rJMFF022D22- TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
rJMSF024F17- TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
rJMSF008N18- TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
rJMSF041H13- TCCATGGCACCACGCAACCAANGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAANTT
rJMSF040H13- TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMFN032L22+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMFN031K18+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMFF032N22+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMSF003B20- GCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMFF027F24+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMSF024F17+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMSF045M16+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMFF022D22+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMSF041H13+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
JMSF040H13+ TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
                      ____________________________________________________________
consensus TCCATGGCACCACGCAACCAAGGTGGGTGCAAACAGCGTTGATCCCGTAGGTTGCAAGTT
 
. : . : . : . : . : . :
rJMFF027F24- GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMFN006E11+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
rJMFF022D22- GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
rJMSF024F17- GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
rJMSF008N18- GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
rJMSF041H13- GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
rJMSF040H13- GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMFN032L22+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMFN031K18+ GCCCGTCATTCTTGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMFF032N22+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMSF003B20- GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMFF027F24+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMSF024F17+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMSF045M16+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMFF022D22+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMSF041H13+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
JMSF040H13+ GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
                      ____________________________________________________________
consensus GCCCGTCATTCTCGACAACAAGATAGGTGGGGTCTCCCTTCAACCCTTGGGTGAGGGTAC
 
. : . : . : . : . : . :
rJMFF027F24- GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMFN006E11+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
rJMFF022D22- GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
rJMSF024F17- GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
rJMSF008N18- GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
rJMSF041H13- GGTTCCCAGGTGCATGAGTCTTTANCCACTCANAAGCAAGGACATCATTTCCTAGGGCAT
rJMSF040H13- GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMFN032L22+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMFN031K18+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMFF032N22+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCACTTCCTAGGGCAT
JMSF003B20- GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMFF027F24+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMSF024F17+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMSF045M16+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMFF022D22+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMSF041H13+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
JMSF040H13+ GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
                      ____________________________________________________________
consensus GGTTCCCAGGTGCATGAGTCTTTAGCCACTCAGAAGCAAGGACATCATTTCCTAGGGCAT
 
. : . : . : . : . : . :
rJMFF027F24- CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMFN006E11+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
rJMFF022D22- CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
rJMSF024F17- CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
rJMSF008N18- CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
rJMSF041H13- CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCNAGGAGGTACAAAGAANGCTGCAT
rJMSF040H13- CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMFN032L22+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMFN031K18+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMFF032N22+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMSF003B20- CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMFF027F24+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMSF024F17+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMSF045M16+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMFF022D22+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMSF041H13+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
JMSF040H13+ CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
                      ____________________________________________________________
consensus CCTTAGCAACGGTACCACCACTTCCACCTCCCGACCCAGGAGGTACAAAGAAGGCTGCAT
 
. : . : . : . : . : . :
rJMFF027F24- AAGGTACCAACATGGCAGAA
JMFN006E11+ AAG
rJMFF022D22- AAGGTGCCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
rJMSF024F17- AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
rJMSF008N18- AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
rJMSF041H13- ANGGTACCAACATGG
rJMSF040H13- AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMFN032L22+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMFN031K18+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMFF032N22+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMSF003B20- AAGGTACCAACATGGCAGAAGAGGG
JMFF027F24+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMSF024F17+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMSF045M16+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMFF022D22+ AAGGTGCCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMSF041H13+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMSF040H13+ AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
JMSF008N18+ ACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
                      ____________________________________________________________
consensus AAGGTACCAACATGGCAGAAGAGGGGAGAGAAAGGGCACCCAAGAGAAGCAAGTTCATGA
 
. : . : . : . : . : . :
rJMFF022D22- GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCG
rJMSF024F17- GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
rJMSF008N18- GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
rJMSF040H13- GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMFN032L22+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMFN031K18+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMFF032N22+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMFF027F24+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMSF024F17+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMSF045M16+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMFF022D22+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMSF041H13+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATANTGGTGGCCATGCACG
JMSF040H13+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
JMSF008N18+ GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
                      ____________________________________________________________
consensus GCTGCCTCTTACCCATATCCGGCACCCGATCGTCGGCCGGAATACTGGTGGCCATGCACG
 
. : . : . : . : . : . :
rJMSF024F17- TGANCCTCA
rJMSF008N18- TGACCCTCAACCC
rJMSF040H13- TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMFN032L22+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMFN031K18+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCAACATCAACG
JMFF032N22+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMFF027F24+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMSF024F17+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMSF045M16+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMFF022D22+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMSF041H13+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMSF040H13+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
JMSF008N18+ TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
                      ____________________________________________________________
consensus TGACCCTCAACCCCTTCTTCCTCCCGCCGGCGCCGCTCCTCACGGATTTCACCATCAACG
 
. : . : . : . : . : . :
rJMSF040H13- CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCAT
JMFN032L22+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMFN031K18+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMFF032N22+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMFF027F24+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMSF024F17+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMSF045M16+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGTAGTGACGG
JMFF022D22+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMSF041H13+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMSF040H13+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
JMSF008N18+ CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
                      ____________________________________________________________
consensus CTTGGGAGCCGCCGGAGCACATGCCATTCCTGCTCGAGCATAGCTGAGAAGGAGTGACGG
 
. : . : . : . : . : . :
JMFN032L22+ GTGGGAGTGT
JMFN031K18+ GTGAGAGTGTGGAAGAAG
JMFF032N22+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGATTTTGTTTTGCTGAT
JMFF027F24+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGTTTTT
JMSF024F17+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGATTTTGTTTTGCTGATAGTG
JMSF045M16+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGATTTTGTTTTGCTGATAGTGT
JMFF022D22+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGC
JMSF041H13+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGATTTTGTTTTGCTGATAGTGT
JMSF040H13+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGATTTTGTTTTGCTGATAGTGT
JMSF008N18+ GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGATTTTGTTTTGCTGATAGTGTAGAA
                      ____________________________________________________________
consensus GTGAGAGTGTGGAAGAAGCCATGAATTTTTGCGCGATTTTGTTTTGCTGATAGTGTAGAA
 
. : . : . : . : . : . :
JMSF008N18+ GAAAAAATGGAGGGAGGGTAGGAGAGGAGATTTGATGACCAAGGATGAAATGATTGGACC
                      ____________________________________________________________
consensus GAAAAAATGGAGGGAGGGTAGGAGAGGAGATTTGATGACCAAGGATGAAATGATTGGACC