Previous Contig 005032:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008N12Sequence274005032 (2)743011471 (2)gb:AF085279_17671545e-68Arabidopsis thaliana ABA-regulated gene cluster, complete sequence.
JMSF043N09Sequence765005032 (2)gb:AF085279_17671549e-78Arabidopsis thaliana ABA-regulated gene cluster, complete sequence.730011471 (2)gb:AF085279_17671541e-67Arabidopsis thaliana ABA-regulated gene cluster, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043N09+ CAATCAAGGCATCATTGTTGTACATAGAGCTCCGAGAATGAACAC
                      ____________________________________________________________
consensus CAATCAAGGCATCATTGTTGTACATAGAGCTCCGAGAATGAACAC
 
. : . : . : . : . : . :
JMSF043N09+ GTGACAGCATATCCAAACTAATTGTAGGATAATGTGTATAGCACATAACTTTGCAGCCAA
                      ____________________________________________________________
consensus GTGACAGCATATCCAAACTAATTGTAGGATAATGTGTATAGCACATAACTTTGCAGCCAA
 
. : . : . : . : . : . :
JMSF043N09+ AAATCCGGGCAACAGGATAGGTAAAAGCATATCCACTCGTATCAAGATAGAACAGAGGAG
                      ____________________________________________________________
consensus AAATCCGGGCAACAGGATAGGTAAAAGCATATCCACTCGTATCAAGATAGAACAGAGGAG
 
. : . : . : . : . : . :
JMSF043N09+ TGAACTTGGATAAAGCTTCCCATGAAAGATAGATGGAACCAAAGCTTTGACCAATCATTG
                      ____________________________________________________________
consensus TGAACTTGGATAAAGCTTCCCATGAAAGATAGATGGAACCAAAGCTTTGACCAATCATTG
 
. : . : . : . : . : . :
JMSF043N09+ TAAATCGAGGGTACGTAGTTTCTTCAATCCACTTTCTCTTATATAGATGGACCACCTGAG
                      ____________________________________________________________
consensus TAAATCGAGGGTACGTAGTTTCTTCAATCCACTTTCTCTTATATAGATGGACCACCTGAG
 
. : . : . : . : . : . :
JMSF043N09+ GATGGTGAAGCAATTTGACACCAAATCGGTCAAAGGCGCGAGCGTTGAGAGTTTGGGGAG
                      ____________________________________________________________
consensus GATGGTGAAGCAATTTGACACCAAATCGGTCAAAGGCGCGAGCGTTGAGAGTTTGGGGAG
 
. : . : . : . : . : . :
JMSF043N09+ TAGCATCATGATCACCGGTGTAAATTACGCAGTTGAGATCAGGGCGTTCGTCTTGGATAG
                      ____________________________________________________________
consensus TAGCATCATGATCACCGGTGTAAATTACGCAGTTGAGATCAGGGCGTTCGTCTTGGATAG
 
. : . : . : . : . : . :
JMSF043N09+ CCTTTACAGCACACCAGAGGACTCGCTCTCCACCGCCGCCGTCATTGGTGTAAGGGTGGA
                      ____________________________________________________________
consensus CCTTTACAGCACACCAGAGGACTCGCTCTCCACCGCCGCCGTCATTGGTGTAAGGGTGGA
 
. : . : . : . : . : . :
JMSF043N09+ AGAATCCAACGGCTTTCTTCCTGTTCCGCCGCCCACCGAGCACGATTACGGCAAGCCGCA
JMSF008N12+ CGCCGCCCACCGAGCACGATTACGGCAAGCCGCA
                      ____________________________________________________________
consensus AGAATCCAACGGCTTTCTTCCTGTTCCGCCGCCCACCGAGCACGATTACGGCAAGCCGCA
 
. : . : . : . : . : . :
JMSF043N09+ GCACAGGGGTAAGTACTAGCGATATGACTGTGATCAGAACCCAATTCGCCATTAACCCAA
JMSF008N12+ GCACAGGGGTAAGTACTAGCGATATGACTGTGATCAGAACCCAATTCGCCATTAACCCAA
                      ____________________________________________________________
consensus GCACAGGGGTAAGTACTAGCGATATGACTGTGATCAGAACCCAATTCGCCATTAACCCAA
 
. : . : . : . : . : . :
JMSF043N09+ ATTTTCTCTTCGATCTAGAGAAGATCCAACTCTGAGAAGCCTATAGATTTTTACTTGTTC
JMSF008N12+ ATTTTCTCTTCGATCTAGAGAAGATCCAACTCTGAGAAGCCTATAGATTTTTACTTGTTC
                      ____________________________________________________________
consensus ATTTTCTCTTCGATCTAGAGAAGATCCAACTCTGAGAAGCCTATAGATTTTTACTTGTTC
 
. : . : . : . : . : . :
JMSF043N09+ CCAGAATAATTGTTACTTGTTCGGGTGTAGATGAAGCCGAAGACGGTGGTCGAAGTGGCG
JMSF008N12+ CCAGAATAATTGTTACTTGTTCGGGTGTAGATGAAGCCGAAGACGGTGGTCGAAGTGGCG
                      ____________________________________________________________
consensus CCAGAATAATTGTTACTTGTTCGGGTGTAGATGAAGCCGAAGACGGTGGTCGAAGTGGCG
 
. : . : . : . : . : . :
JMSF043N09+ ATGGACTAATGGGTGTTGCCGTGTTGCGTTGCGGCGGCGGGGCGGCGACCGGAGAAGACC
JMSF008N12+ ATGGACTAATGGGTGTTGCCGTGTTGCGTTGCGGCGGCGGGGCGGCGACCGGAGAAGACC
                      ____________________________________________________________
consensus ATGGACTAATGGGTGTTGCCGTGTTGCGTTGCGGCGGCGGGGCGGCGACCGGAGAAGACC